Skip to content

E
edx-platform
Commit 38378cda by srpearce
Options

Merge pull request #3360 from edx/DOC-224 

Doc 224
parents b2933250 c85a1557
Showing with 2804 additions and 272 deletions
docs/en_us/course_authors/source/Format Cheat Sheet.rstnouse
******************
##################
Format cheat sheet
******************
##################
Levels of Subheads
Title: # above and below (as lines 1 and 3 above)
####
text
####
****
text
****
text
****
text
====
text
^^^^
*********
Heading 1
*********
=========
Heading 2
=========
Heading 3
*********
Heading 4
=========
Heading 5
^^^^^^^^^
************
Image Format
************
Image format, uses images as a reference from the soure/image file
......@@ -34,10 +33,9 @@ Image format, uses images as a reference from the soure/image file
.. image:: images/image009.png
:width: 800
For references to edX1010 pages:
`Writing Exercises <https://edge.edx.org/courses/edX/edX101/How_to_Create_an_edX_Course/courseware/a45de3baa8a9468cbfb1a301fdcd7e86/d15cfeaff0af4dd7be4765cd0988d172/1>`_ has more in-depth discussion about problem types, and some general pedagogical considerations for adapting to the online format and a `Gallery of Response Types <https://edge.edx.org/accounts/login?next=/courses/edX/edX101/How_to_Create_an_edX_Course/courseware/a45de3baa8a9468cbfb1a301fdcd7e86/3ba055e760d04f389150a75edfecb844/1>`_
****************
Code Formatting
****************
To set text in a "Code format"
::
......@@ -47,6 +45,52 @@ To set text in a "Code format"
(text in code-block:: xml is in different colors)
****************
Table Formatting
****************
With a header row
.. list-table::
:widths: 10 80
:header-rows: 1
* - First Name
- Last Name
- Residence
* - Elizabeth
- Bennett
- Longbourne
* - Fitzwilliam
- Darcy
- Pemberley
-- or --
With a bolded first column
.. list-table::
:widths: 10 80
:stub-columns: 1
* - First Name
- Elizabeth
- Fitzwilliam
* - Last Name
- Bennett
- Darcy
* - Residence
- Longboure
- Pemberley
*******************
Cross-References
*******************
For references to edX101 pages:
`Writing Exercises <https://edge.edx.org/courses/edX/edX101/How_to_Create_an_edX_Course/courseware/a45de3baa8a9468cbfb1a301fdcd7e86/d15cfeaff0af4dd7be4765cd0988d172/1>`_ has more in-depth discussion about problem types, and some general pedagogical considerations for adapting to the online format and a `Gallery of Response Types <https://edge.edx.org/accounts/login?next=/courses/edX/edX101/How_to_Create_an_edX_Course/courseware/a45de3baa8a9468cbfb1a301fdcd7e86/3ba055e760d04f389150a75edfecb844/1>`_
To cross reference between sections of a document
At the paragraph you are cross referencing:
......
docs/en_us/course_authors/source/change_log.rst
......@@ -12,6 +12,8 @@ April, 2014
* - Date
- Change
* - 4/23/14
- Reorganized info about problems into :ref:`Exercises and Tools Index` section
* - 04/22/14
- Updated the :ref:`Bulk Email` section with information about the dashboard option to opt out of course email.
* -
......@@ -37,7 +39,6 @@ April, 2014
new HTML editor.
* - 04/07/14
- Expanded the :ref:`Course Data`, :ref:`Enrollment`, and
:ref:`Course_Staffing` sections.
* - 04/03/14
- Updated the :ref:`Adding Pages to a Course` chapter to reflect ability to :ref:`Show or Hide the Course Wiki Page`.
* - 04/02/14
......@@ -82,7 +83,7 @@ March, 2014
* :ref:`Creating Course Content Index`
* :ref:`Working with Problems Index`
* :ref:`Exercises and Tools Index`
* :ref:`Releasing Your Course Index`
......@@ -140,19 +141,18 @@ February, 2014
- Added the :ref:`Course Data`, :ref:`Course_Staffing`, and
:ref:`Enrollment` chapters.
* - 02/11/14
- Added :ref:`Gene Explorer` and updated :ref:`Interactive Periodic Table`
and :ref:`Molecule Editor` in :ref:`Additional Tools`.
- Added :ref:`Gene Explorer` and updated :ref:`Periodic Table`
and :ref:`Molecule Editor`.
* - 02/07/14
- Added section on :ref:`Full Screen Image`.
* - 02/06/14
- Added :ref:`Interactive Periodic Table` and :ref:`Molecule Editor` to
:ref:`Additional Tools`
- Added :ref:`Periodic Table` and :ref:`Molecule Editor`
* - 02/05/14
- Added section :ref:`Set the Advertised Start Date`.
* - 02/04/14
- Added the :ref:`Student Data` and :ref:`Grades` chapters.
* -
- Added :ref:`Additional Tools` topic with :ref:`Multiple Choice and
- Added :ref:`Multiple Choice and
Numerical Input` and :ref:`Protein Builder`.
......@@ -167,7 +167,7 @@ January, 2014
* - Date
- Change
* - 01/29/2014
- Added the chapter :ref:`Using an Instant Hangout in Your Course`.
- Added the chapter :ref:`Google Instant Hangout`.
* - 01/24/2014
- Added the :ref:`Discussions` and :ref:`Guidance for Discussion
Moderators` chapters.
......@@ -178,7 +178,7 @@ January, 2014
Textbooks`.
* - 01/14/2014
- Added info about scoring (:ref:`ORA Access Scores`) and due dates in
:ref:`Open Response Assessment Problems`.
:ref:`Open Response Assessment`.
* - 01/13/2014
- Extensive updates to :ref:`Organizing Your Course Content` and
:ref:`Working with HTML Components`.
......@@ -193,7 +193,7 @@ January, 2014
* -
- Added info about template to :ref:`Checkbox`.
* - 01/06/2014
- Created :ref:`Custom JavaScript Display and Grading`
- Created :ref:`Custom JavaScript`
* - 01/06/2014
- Created :ref:`Zooming image`
* - 01/01/2014
......@@ -215,7 +215,7 @@ December, 2013
- Made :ref:`ORA for Students` into template that instructors can
customize.
* - 12/19/2013
- Created :ref:`Tools`.
- Created "Tools" topic. (Note 4/10/14: Topic merged into :ref:`Create Exercises`.)
* - 12/18/2013
- Updated documentation about video player options in :ref:`Working with
Video Components`.
......@@ -229,7 +229,7 @@ December, 2013
- Added the chapter :ref:`Guidelines for Creating Accessible Content`.
* - 12/10/2013
- Added note about number of responses in "Available to Grade" column in
:ref:`Open Response Assessment Problems`.
:ref:`Open Response Assessment`.
* -
- Added :ref:`MathJax in Studio`.
* - 12/09/2013
......
docs/en_us/course_authors/source/creating_content/create_html_component.rst
......@@ -21,7 +21,7 @@ For more information, see the following topics:
.. note:: Review :ref:`Organizing Your Course Content` and :ref:`Best Practices for HTML Markup` before you start working with HTML components.
To add an instant hangout to an HTML component, see :ref:`Using an Instant Hangout in Your Course`.
To add an instant hangout to an HTML component, see :ref:`Google Instant Hangout`.
.. _The HTML Editor:
......
docs/en_us/course_authors/source/creating_content/index.rst
......@@ -17,4 +17,5 @@ Creating Course Content
create_html_component
create_video
create_discussion
create_problem
docs/en_us/course_authors/source/creating_content/pages.rst
......@@ -33,7 +33,7 @@ You can create other pages for the grading policy, course slides, or any other p
* A dynamic HTML calendar, using the template in :ref:`Code for Dynamic HTML Schedule`.
* An instant hangout. See :ref:`Using an Instant Hangout in Your Course` for more information.
* An instant hangout. See :ref:`Google Instant Hangout` for more information.
See:
......
docs/en_us/course_authors/source/exercises_tools/annotation.rst 0 → 100644
.. _Annotation:
###################
Annotation Problem
###################
In an annotation problem, the instructor highlights specific text inside a larger text block and then asks questions about that text. The questions appear when students hover the mouse over the highlighted text. The questions also appear in a section below the text block, along with space for students' responses.
Annotation problems ask students to respond to questions about a specific block of text. The question appears above the text when the student hovers the mouse over the highlighted text so that students can think about the question as they read.
.. image:: /Images/AnnotationExample.png
:alt: Annotation problem
****************************
Create an Annotation Problem
****************************
To create an annotation problem, you'll add the Annotation advanced component to your course, add the **Instructions** and **Guided Discussion** segments of the problem, and then the **Annotation problem** segment of the problem.
#. Add the Annotation advanced component.
#. On the **Settings** menu, click **Advanced Settings**.
#. On the **Advanced Settings** page, locate the **Manual Policy Definition** section, and then locate the **advanced_modules** policy key (this key is at the top of the list).
.. image:: /Images/AdvancedModulesEmpty.png
:alt: Image of the Manual Policy Definition section of the Advanced Settings page
3. Under **Policy Value**, place your cursor between the brackets, and
then enter the following. Make sure to include the quotation marks.
``"annotatable"``
#. At the bottom of the page, click **Save Changes**.
The page refreshes automatically. At the top of the page, you see a
notification that your changes have been saved.
#. Return to the unit where you want to add the specialized problem. The
list of possible components now contains an Advanced component.
.. image:: /Images/AdvancedComponent.png
:alt: Image of the Add a New Component panel with the Advanced component option
2. Add the **Instructions** and **Guided Discussion** segments of the
problem.
#. In the unit where you want to create the problem, click **Advanced**
under **Add New Component**.
#. In the list of problem types, click **Annotation**.
#. In the component that appears, click **Edit**.
#. In the component editor, replace the example code with your own code.
#. Click **Save**.
3. Add the **Annotation problem** segment of the problem.
#. Under the Annotation component, create a new blank Advanced Problem
component.
#. Paste the following code in the Advanced Problem component, replacing
placeholders with your own information.
.. code-block:: xml
<problem>
<annotationresponse>
<annotationinput>
<text>PLACEHOLDER: Text of annotation</text>
<comment>PLACEHOLDER: Text of question</comment>
<comment_prompt>PLACEHOLDER: Type your response below:</comment_prompt>
<tag_prompt>PLACEHOLDER: In your response to this question, which tag below
do you choose?</tag_prompt>
<options>
<option choice="incorrect">PLACEHOLDER: Incorrect answer (to make this
option a correct or partially correct answer, change choice="incorrect"
to choice="correct" or choice="partially-correct")</option>
<option choice="correct">PLACEHOLDER: Correct answer (to make this option
an incorrect or partially correct answer, change choice="correct" to
choice="incorrect" or choice="partially-correct")</option>
<option choice="partially-correct">PLACEHOLDER: Partially correct answer
(to make this option a correct or partially correct answer,
change choice="partially-correct" to choice="correct" or choice="incorrect")
</option>
</options>
</annotationinput>
</annotationresponse>
<solution>
<p>PLACEHOLDER: Detailed explanation of solution</p>
</solution>
</problem>
#. Click **Save**.
docs/en_us/course_authors/source/exercises_tools/checkbox.rst 0 → 100644
.. _Checkbox:
##################
Checkbox Problem
##################
In checkbox problems, the student selects one or more options from a list of possible answers. The student must select all the options that apply to answer the problem correctly. Each checkbox problem must have at least one correct answer.
.. image:: /Images/CheckboxExample.png
:alt: Image of a checkbox problem
****************************
Create a Checkbox Problem
****************************
You can create checkbox problems in the Simple Editor or in the Advanced Editor.
.. note:: All problems must include labels for accessibility. The label generally includes the text of the main question in your problem. To add a label for a common problem, surround the text of the label with angle brackets pointed toward the text (>>label text<<).
==================
Simple Editor
==================
#. Under **Add New Component**, click **Problem**.
#. In the **Select Problem Component Type** screen, click **Checkboxes** on the **Common Problem Types** tab.
#. In the Problem component that appears, click **Edit**.
#. In the component editor, replace the default text with the text of your
problem. Enter each answer option on its own line.
#. Determine the text of the problem to use as a label, and then surround that text with two sets of angle brackets (>><<).
#. Select all the answer options, and then click the checkbox button.
.. image:: /Images/ProbComponent_CheckboxIcon.png
:alt: Image of the checkbox button
When you do this, brackets appear next to each answer choice.
#. Add an **x** between the brackets for the correct answer or answers.
#. In the component editor, select the text of the explanation, and then click the
explanation button to add explanation tags around the text.
.. image:: /Images/ProbCompButton_Explanation.png
:alt: Image of the explanation button
#. On the **Settings** tab, specify the settings that you want.
#. Click **Save**.
For the example problem above, the text in the Problem component is the
following.
.. code-block:: xml
Learning about the benefits of preventative healthcare can be particularly
difficult. >>Check all of the reasons below why this may be the case.<<
[x] A large amount of time passes between undertaking a preventative measure and seeing the result.
[ ] Non-immunized people will always fall sick.
[x] If others are immunized, fewer people will fall sick regardless of a particular individual's choice to get immunized or not.
[x] Trust in healthcare professionals and government officials is fragile.
[explanation]
People who are not immunized against a disease may still not fall sick from the disease. If someone is trying to learn whether or not preventative measures against the disease have any impact, he or she may see these people and conclude, since they have remained healthy despite not being immunized, that immunizations have no effect. Consequently, he or she would tend to believe that immunization
(or other preventative measures) have fewer benefits than they actually do.
[explanation]
==================
Advanced Editor
==================
To create this problem in the Advanced Editor, click the **Advanced** tab in the Problem component editor, and then replace the existing code with the following code.
.. code-block:: xml
<problem>
<startouttext/>
<p>Learning about the benefits of preventative healthcare can be particularly difficult. Check all of the reasons below why this may be the case.</p>
<choiceresponse>
<checkboxgroup direction="vertical" label="Check all of the reasons below why this may be the case">
<choice correct="true"><text>A large amount of time passes between undertaking a preventative measure and seeing the result.</text></choice>
<choice correct="false"><text>Non-immunized people will always fall sick.</text></choice>
<choice correct="true"><text>If others are immunized, fewer people will fall sick regardless of a particular individual's choice to get immunized or not.</text></choice>
<choice correct="true"><text>Trust in healthcare professionals and government officials is fragile.</text></choice>
</checkboxgroup>
<solution>
<div class="detailed-solution">
<p>Explanation</p>
<p>People who are not immunized against a disease may still not fall sick from the disease. If someone is trying to learn whether or not preventative measures against the disease have any impact, he or she may see these people and conclude, since they have remained healthy despite not being immunized, that immunizations have no effect. Consequently, he or she would tend to believe that immunization (or other preventative measures) have fewer benefits than they actually do.</p>
</div>
</solution>
</choiceresponse>
</problem>
.. _Checkbox Problem XML:
****************************
Checkbox Problem XML
****************************
============
Template
============
.. code-block:: xml
<problem>
<startouttext/>
<p>Question text</p>
<choiceresponse>
<checkboxgroup direction="vertical" label="label text">
<choice correct="false"><text>Answer option 1 (incorrect)</text></choice>
<choice correct="true"><text>Answer option 2 (correct)</text></choice>
</checkboxgroup>
<solution>
<div class="detailed-solution">
<p>Solution or Explanation Heading</p>
<p>Solution or explanation text</p>
</div>
</solution>
</choiceresponse>
</problem>
======
Tags
======
* ``<choiceresponse>`` (required): Specifies that the problem contains options for students to choose from.
* ``<checkboxgroup>`` (required): Specifies that the problem is a checkbox problem.
* ``<choice>`` (required): Designates an answer option.
**Tag:** ``<choiceresponse>``
Specifies that the problem contains options for students to choose from.
Attributes
(none)
Children
* ``<checkboxgroup>``
**Tag:** ``<checkboxgroup>``
Specifies that the problem is a checkbox problem.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - direction (optional)
- Specifies the orientation of the list of answers. The default is vertical.
* - label (required)
- Specifies the name of the response field.
Children
* ``<choice>``
**Tag:** ``<choice>``
Designates an answer option.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - true (at least one required)
- Indicates a correct answer. For checkbox problems, one or more ``<choice>`` tags can contain a correct answer.
* - false (at least one required)
- Indicates an incorrect answer.
Children
(none)
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/chemical_equation.rst 0 → 100644
.. _Chemical Equation:
################################
Chemical Equation Problem
################################
The chemical equation problem type allows the student to enter text that represents a chemical equation into a text box. The system converts that text into a chemical equation below the text box. The grader evaluates the student's response by using a Python script that you create and embed in the problem.
.. image:: /Images/ChemicalEquationExample.png
:alt: Image of a chemical equation response problem
************************************
Create the Chemical Equation Problem
************************************
Chemical equation problems use MathJax to create formulas. For more information about using MathJax in Studio, see :ref:`MathJax in Studio`.
To create the above chemical equation problem:
#. In the unit where you want to create the problem, click **Problem** under **Add New Component**, and then click the **Advanced** tab.
#. Click **Blank Advanced Problem**.
#. In the component that appears, click **Edit**.
#. In the component editor, paste the code from below.
#. Click **Save**.
==========================================
Sample Chemical Equation Problem Code
==========================================
.. code-block:: xml
<problem>
<startouttext/>
<p>Some problems may ask for a particular chemical equation. Practice by writing out the following reaction in the box below.</p>
\( \text{H}_2\text{SO}_4 \longrightarrow \text { H}^+ + \text{ HSO}_4^-\)
<customresponse>
<chemicalequationinput size="50" label="Enter the chemical equation"/>
<answer type="loncapa/python">
if chemcalc.chemical_equations_equal(submission[0], 'H2SO4 -> H^+ + HSO4^-'):
correct = ['correct']
else:
correct = ['incorrect']
</answer>
</customresponse>
<p>Some tips:</p>
<ul>
<li>Use real element symbols.</li>
<li>Create subscripts by using plain text.</li>
<li>Create superscripts by using a caret (^).</li>
<li>Create the reaction arrow (\(\longrightarrow\)) by using "->".</li>
</ul>
<endouttext/>
<solution>
<div class="detailed-solution">
<p>Solution</p>
<p>To create this equation, enter the following:</p>
<p>H2SO4 -> H^+ + HSO4^-</p>
</div>
</solution>
</problem>
.. _Chemical Equation Problem XML:
************************************
Chemical Equation Problem XML
************************************
============
Template
============
.. code-block:: xml
<problem>
<startouttext/>
<p>Problem text</p>
<customresponse>
<chemicalequationinput size="NUMBER" label="LABEL TEXT"/>
<answer type="loncapa/python">
if chemcalc.chemical_equations_equal(submission[0], 'TEXT REPRESENTING CHEMICAL EQUATION'):
correct = ['correct']
else:
correct = ['incorrect']
</answer>
</customresponse>
<endouttext/>
<solution>
<div class="detailed-solution">
<p>Solution or Explanation Header</p>
<p>Solution or explanation text</p>
</div>
</solution>
</problem>
======
Tags
======
* ``<customresponse>``: Indicates that this problem has a custom response.
* ``<chemicalequationinput>``: Specifies that the answer to this problem is a chemical equation.
* ``<answer type=loncapa/python>``: Contains the Python script that grades the problem.
**Tag:** ``<customresponse>``
Indicates that this problem has a custom response. The ``<customresponse>`` tags must surround the ``<chemicalequation>`` tags.
Attributes
(none)
Children
* ``<chemicalequationinput>``
* ``<answer>``
**Tag:** ``<chemicalequationinput>``
Indicates that the answer to this problem is a chemical equation and creates a response field where the student enters an answer.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - size
- Specifies the size of the response field, in characters.
* - label (required)
- Contains the text of the principal question in the problem.
Children
(none)
**Tag:** ``<answer>``
Contains the Python script that grades the problem.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - type (required)
- Must be "loncapa/python".
Children
(none)
docs/en_us/course_authors/source/exercises_tools/circuit_schematic_builder.rst 0 → 100644
.. _Circuit Schematic Builder:
##################################
Circuit Schematic Builder Problem
##################################
In circuit schematic builder problems, students can arrange circuit elements such as voltage sources, capacitors, resistors, and MOSFETs on an interactive grid. They then submit a DC, AC, or transient analysis of their circuit to the system for grading.
.. image:: /Images/CircuitSchematicExample.png
:alt: Image of a circuit schematic builder
*********************************************
Create a Circuit Schematic Builder Problem
*********************************************
#. In the unit where you want to create the problem, click **Problem**
under **Add New Component**, and then click the **Advanced** tab.
#. Click **Circuit Schematic Builder**.
#. In the component that appears, click **Edit**.
#. In the component editor, replace the example code with your own code.
#. Click **Save**.
**Problem Code**
To create the problem in the image above, paste the following code into the Advanced Editor.
.. code-block:: xml
<problem>
<p>Make a voltage divider that splits the provided voltage evenly.</p>
<schematicresponse>
<center>
<schematic height="500" width="600" parts="g,r" analyses="dc"
initial_value="[["v",[168,144,0],{"value":"dc(1)","_json_":0},["1","0"]],["r",[296,120,0],{"r":"1","_json_":1},["1","output"]],["L",[296,168,3],{"label":"output","_json_":2},["output"]],["w",[296,216,168,216]],["w",[168,216,168,192]],["w",[168,144,168,120]],["w",[168,120,296,120]],["g",[168,216,0],{"_json_":7},["0"]],["view",-67.49999999999994,-78.49999999999994,1.6000000000000003,"50","10","1G",null,"100","1","1000"]]"
/>
</center>
<answer type="loncapa/python">
dc_value = "dc analysis not found"
for response in submission[0]:
if response[0] == 'dc':
for node in response[1:]:
dc_value = node['output']
if dc_value == .5:
correct = ['correct']
else:
correct = ['incorrect']
</answer>
</schematicresponse>
<schematicresponse>
<p>Make a high pass filter.</p>
<center>
<schematic height="500" width="600" parts="g,r,s,c" analyses="ac"
submit_analyses="{"ac":[["NodeA",1,9]]}"
initial_value="[["v",[160,152,0],{"name":"v1","value":"sin(0,1,1,0,0)","_json_":0},["1","0"]],["w",[160,200,240,200]],["g",[160,200,0],{"_json_":2},["0"]],["L",[240,152,3],{"label":"NodeA","_json_":3},["NodeA"]],["s",[240,152,0],{"color":"cyan","offset":"0","_json_":4},["NodeA"]],["view",64.55878906250004,54.114697265625054,2.5000000000000004,"50","10","1G",null,"100","1","1000"]]"/>
</center>
<answer type="loncapa/python">
ac_values = None
for response in submission[0]:
if response[0] == 'ac':
for node in response[1:]:
ac_values = node['NodeA']
print "the ac analysis value:", ac_values
if ac_values == None:
correct = ['incorrect']
elif ac_values[0][1] < ac_values[1][1]:
correct = ['correct']
else:
correct = ['incorrect']
</answer>
</schematicresponse>
<solution>
<div class="detailed-solution">
<p>Explanation</p>
<p>A voltage divider that evenly divides the input voltage can be formed with two identically valued resistors, with the sampled voltage taken in between the two.</p>
<p><img src="/c4x/edX/edX101/asset/images_voltage_divider.png"/></p>
<p>A simple high-pass filter without any further constaints can be formed by simply putting a resister in series with a capacitor. The actual values of the components do not really matter in order to meet the constraints of the problem.</p>
<p><img src="/c4x/edX/edX101/asset/images_high_pass_filter.png"/></p>
</div>
</solution>
</problem>
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/conditional_module.rst 0 → 100644
.. _Conditional Module:
####################
Conditional Module
####################
********************
Format description
********************
The main tag of conditional module input is:
.. code-block:: xml
<conditional> ... </conditional>
``conditional`` can include any number of any xmodule tags (``html``, ``video``, ``poll``, etc.) or ``show`` tags.
================
conditional tag
================
The main container for a single instance of a conditional module. The following attributes can
be specified for this tag:
.. code-block:: xml
sources - location id of required modules, separated by ';'
[message | ""] - message for case, where one or more are not passed. Here you can use variable {link}, which generate link to required module.
[submitted] - map to `is_submitted` module method.
(pressing RESET button makes this function to return False.)
[correct] - map to `is_correct` module method
[attempted] - map to `is_attempted` module method
[poll_answer] - map to `poll_answer` module attribute
[voted] - map to `voted` module attribute
========
show tag
========
Symlink to some set of xmodules. The following attributes can
be specified for this tag:
.. code-block:: xml
sources - location id of modules, separated by ';'
*********
Example
*********
========================================
Examples of conditional depends on poll
========================================
.. code-block:: xml
<conditional sources="i4x://MITx/0.000x/poll_question/first_real_poll_seq_with_reset" poll_answer="man"
message="{link} must be answered for this to become visible.">
<html>
<h2>You see this because your vote value for "First question" was "man"</h2>
</html>
</conditional>
========================================================
Examples of conditional depends on poll (use <show> tag)
========================================================
.. code-block:: xml
<conditional sources="i4x://MITx/0.000x/poll_question/first_real_poll_seq_with_reset" poll_answer="man"
message="{link} must be answered for this to become visible.">
<html>
<show sources="i4x://MITx/0.000x/problem/test_1; i4x://MITx/0.000x/Video/Avi_resources; i4x://MITx/0.000x/problem/test_1"/>
</html>
</conditional>
================================================
Examples of conditional depends on problem
================================================
.. code-block:: xml
<conditional sources="i4x://MITx/0.000x/problem/Conditional:lec27_Q1" attempted="True">
<html display_name="HTML for attempted problem">You see this, cause "lec27_Q1" is attempted.</html>
</conditional>
<conditional sources="i4x://MITx/0.000x/problem/Conditional:lec27_Q1" attempted="False">
<html display_name="HTML for not attempted problem">You see this because "lec27_Q1" is not attempted.</html>
</conditional>
docs/en_us/course_authors/source/exercises_tools/drag_and_drop.rst 0 → 100644
.. _Drag and Drop:
##########################
Drag and Drop Problem
##########################
In drag and drop problems, students respond to a question by dragging text or objects to a specific location on an image.
.. image:: /Images/DragAndDropProblem.png
:alt: Image of a drag and drop problem
*********************************
Create a Drag and Drop Problem
*********************************
To create a drag and drop problem, you'll need the following files:
* Allopurinol.gif
* AllopurinolAnswer.gif
To download both these files in a .zip archive, go to http://files.edx.org/DragAndDropProblemFiles.zip.
To create the molecule editor that appears in the image above, you'll upload the files for this problem, and then paste the code below into a Problem component.
#. Upload the Allopurinol.gif and AllopurinolAnswer.gif files to the **Files & Uploads** page.
#. In the unit where you want to create the problem, click **Problem** under **Add New Component**, and then click the **Advanced** tab.
#. Click **Drag and Drop**.
#. In the component that appears, click **Edit**.
#. In the component editor, replace the example code with the following code.
#. Click **Save**.
**Problem Code**:
.. code-block:: xml
<problem>
<p> Allopurinol is a drug used to treat and prevent gout, a very painful form of arthritis. Once only a “rich man’s disease”, gout has become more and more common in recent decades – affecting about 3 million people in the United States alone. Deposits of needle-like crystals of uric acid in connective tissue or joint spaces cause the symptoms of swelling, stiffness and intense pain. Individuals with gout overproduce uric acid because they cannot eliminate it efficiently. Allopurinol treats and prevents gout by stopping the overproduction of uric acid through inhibition of an enzyme required for the synthesis of uric acid. </p>
<p> You are shown one of many possible molecules. On the structure of allopurinol below, identify the functional groups that are present by dragging the functional group name listed onto the appropriate target boxes on the structure. If you want to change an answer, you have to drag off the name as well. You may need to scroll through the names of functional groups to see all options. </p>
<customresponse>
<drag_and_drop_input no_labels="true" one_per_target="true" target_outline="true" img="/static/Allopurinol.gif">
<draggable can_reuse="true" label="methyl" id="1"/>
<draggable can_reuse="true" label="hydroxyl" id="2"/>
<draggable can_reuse="true" label="amino" id="3"/>
<draggable can_reuse="true" label="carboxyl" id="4"/>
<draggable can_reuse="true" label="aldehyde" id="5"/>
<draggable can_reuse="true" label="phosphate" id="6"/>
<draggable can_reuse="true" label="sulfhydryl" id="7"/>
<draggable can_reuse="true" label="phenyl" id="8"/>
<draggable can_reuse="true" label="none" id="none"/>
<target id="0" h="53" w="66" y="55.100006103515625" x="131.5"/>
<target id="1" h="113" w="55" y="140.10000610351562" x="181.5"/>
</drag_and_drop_input>
<answer type="loncapa/python"> correct_answer = [ {'draggables': ['2'], 'targets': ['0' ], 'rule':'unordered_equal' }, {'draggables': ['none'], 'targets': ['1' ], 'rule':'unordered_equal' }] if draganddrop.grade(submission[0], correct_answer): correct = ['correct'] else: correct = ['incorrect'] </answer>
</customresponse>
<solution>
<img src="/static/AllopurinolAnswer.gif"/>
</solution>
</problem>
.. _Drag and Drop Problem XML:
*********************************
Drag and Drop Problem XML
*********************************
========
Template
========
.. code-block:: xml
<problem>
<p>Problem text</p>
<customresponse>
<drag_and_drop_input no_labels="false" one_per_target="true" target_outline="true" img="/static/TARGET_IMAGE.gif">
<draggable can_reuse="true" label="NAME 1" id="1"/>
<draggable can_reuse="true" label="NAME 2" id="2"/>
<target id="0" h="HEIGHT (in pixels)" w="WIDTH (in pixels)" y="Y-COORDINATE" x="X-COORDINATE"/>
<target id="1" h="HEIGHT (in pixels)" w="WIDTH (in pixels)" y="Y-COORDINATE" x="X-COORDINATE"/>
</drag_and_drop_input>
<answer type="loncapa/python"> correct_answer = [ {'draggables': ['2'], 'targets': ['0' ], 'rule':'unordered_equal' }, {'draggables': ['none'], 'targets': ['1' ], 'rule':'unordered_equal' }] if draganddrop.grade(submission[0], correct_answer): correct = ['correct'] else: correct = ['incorrect'] </answer>
</customresponse>
<solution>
<img src="/static/ANSWER_IMAGE.gif"/>
</solution>
</problem>
========
Tags
========
* ``<drag_and_drop_input/>``: Indicates the problem is a drag and drop problem.
* ``<draggable/>``: Specifies a single object that a student will drag onto the base image.
* ``<target>``: Specifies the location on the base image where a draggable must be dropped.
**Tag:** ``<drag_and_drop_input/>``
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - img (required)
- Relative path to an image that will be the base image. All draggables can be dragged onto it.
* - target_outline
- Specifies whether an outline (gray dashed line) should be drawn around targets (if they are specified). It can be either 'true' or 'false'. If not specified, the targets do not have outlines.
* - one_per_target
- Specify whether to allow more than one draggable to be placed onto a single target. It can be either 'true' or 'false'. If not specified, the default value is 'true'.
* - no_labels (required)
- default is false, in default behaviour if label is not set, label is obtained from id. If no_labels is true, labels are not automatically populated from id, and one can not set labels and obtain only icons.
Children
* ``<draggable>``
* ``<target>``
**Tag:** ``<draggable/>``
Specifies a single draggable object in a drag and drop problem.
A draggable is what the user must drag out of the slider and drop onto the base image. After a drag operation, if the center of the draggable is located outside the rectangular dimensions of the image, it will be returned to the slider.
For the grader to work, each draggable must have a unique ID.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - id (required)
- Unique identifier of the draggable object.
* - label (optional)
- Text label that the user sees.
* - icon (optional)
- For draggables that are images, the relative path to the image file.
* - can_reuse
- true or false, default is false. If true, same draggable can be used multiple times.
Children
(none)
**Tag:** ``<target>``
Specifies the location on the base image where a student must drop a draggable item. By design, if the center of a draggable lies within the target (i.e. in the rectangle defined by [[x, y], [x + w, y + h]], it is within the target. Otherwise, it is outside.
If you specify at least one target, and a student drops a draggable item on a location that is outside a target, the draggable item returns to the slider.
If you don't specify a target, a student can drop a draggable item anywhere on the base image.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - id (required)
- Unique identifier of the target object.
* - x
- X-coordinate on the base image where the top left corner of the target will be positioned.
* - y
- Y-coordinate on the base image where the top left corner of the target will be positioned.
* - w
- Width of the target, in pixels.
* - h
- Height of the target, in pixels.
Children
(none)
For more information about how to create drag and drop problems, see `XML Format of Drag and Drop Input
<https://edx.readthedocs.org/en/latest/course_data_formats/drag_and_drop/drag_and_drop_input.html>`_.
docs/en_us/course_authors/source/exercises_tools/dropdown.rst 0 → 100644
.. _Dropdown:
#####################
Dropdown Problem
#####################
Dropdown problems allow the student to choose from a collection of answer options, presented as a dropdown list. Unlike multiple choice problems, whose answers are always visible directly below the question, dropdown problems don't show answer choices until the student clicks the dropdown arrow.
.. image:: /Images/DropdownExample.png
:alt: Image of a dropdown problem
********************************
Create a Dropdown Problem
********************************
You can create dropdown problems in the Simple Editor or in the Advanced Editor.
.. note:: All problems must include labels for accessibility. The label generally includes the text of the main question in your problem. To add a label for a common problem, surround the text of the label with angle brackets pointed toward the text (>>label text<<).
================
Simple Editor
================
To create a dropdown problem, follow these steps.
#. Under **Add New Component**, click **Problem**.
#. In the **Select Problem Component Type** screen, click
**Dropdown** on the **Common Problem Types** tab.
#. In the new Problem component that appears, click **Edit**.
#. Replace the default text with the text for your problem. Enter each of the possible
answers on the same line, separated by commas.
#. Determine the text of the problem to use as a label, and then surround that text with two sets of angle brackets (>><<).
#. Select all the answer options, and then click the dropdown button.
.. image:: /Images/ProbCompButton_Dropdown.png
:alt: Image of the dropdown button
When you do this, a double set of brackets ([[ ]]) appears and surrounds the
answer options.
#. Inside the brackets, surround the correct answer with parentheses.
#. In the component editor, select the text of the explanation, and then click the
explanation button to add explanation tags around the text.
.. image:: /Images/ProbCompButton_Explanation.png
:alt: Image of the explanation button
#. On the **Settings** tab, specify the settings that you want.
#. Click **Save**.
For the example problem above, the text in the Problem component is the
following.
::
>>What type of data are the following?<<
Age:
[[Nominal, Discrete, (Continuous)]]
Age, rounded to the nearest year:
[[Nominal, (Discrete), Continuous]]
Life stage - infant, child, and adult:
[[(Nominal), Discrete, Continuous]]
================
Advanced Editor
================
To create this problem in the Advanced Editor, click the **Advanced** tab in the Problem component editor, and then replace the existing code with the following code.
**Problem Code:**
.. code-block:: xml
<problem>
<p>
<em>This exercise first appeared in HarvardX's PH207x Health in Numbers: Quantitative Methods in Clinical &amp; Public Health Research course, fall 2012.</em>
</p>
<p>What type of data are the following?</p>
<p>Age:</p>
<optionresponse>
<optioninput options="('Nominal','Discrete','Continuous')" correct="Continuous" label="Age"/>
</optionresponse>
<p>Age, rounded to the nearest year:</p>
<optionresponse>
<optioninput options="('Nominal','Discrete','Continuous')" correct="Discrete" label="Age, rounded to the nearest year"/>
</optionresponse>
<p>Life stage - infant, child, and adult:</p>
<optionresponse>
<optioninput options="('Nominal','Discrete','Continuous')" correct="Nominal" label="Life stage"/>
</optionresponse>
</problem>
.. _Dropdown Problem XML:
************************
Dropdown Problem XML
************************
========
Template
========
.. code-block:: xml
<problem>
<p>
Problem text</p>
<optionresponse>
<optioninput options="('Option 1','Option 2','Option 3')" correct="Option 2" label="label text"/>
</optionresponse>
<solution>
<div class="detailed-solution">
<p>Explanation or Solution Header</p>
<p>Explanation or solution text</p>
</div>
</solution>
</problem>
.. code-block:: xml
<problem>
<p>Problem text</p>
<optionresponse>
options="('A','B')"
correct="A"/>
label="label text"
</optionresponse>
<solution>
<div class="detailed-solution">
<p>Explanation or Solution Header</p>
<p>Explanation or solution text</p>
</div>
</solution>
</problem>
========
Tags
========
* ``<optionresponse>`` (required): Indicates that the problem is a dropdown problem.
* ``<optioninput>`` (required): Lists the answer options.
**Tag:** ``<optionresponse>``
Indicates that the problem is a dropdown problem.
Attributes
(none)
Children
* ``<optioninput>``
**Tag:** ``<optioninput>``
Lists the answer options.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - options (required)
- Lists the answer options. The list of all answer options is surrounded by parentheses. Individual answer options are surrounded by single quotation marks (') and separated by commas (,).
* - correct (required)
- Indicates whether an answer is correct. Possible values are "true" and "false". Only one **correct** attribute can be set to "true".
* - label (required)
- Specifies the name of the response field.
Children
(none)
\ No newline at end of file
docs/en_us/course_authors/source/problems_tools/external_graders.rst → docs/en_us/course_authors/source/exercises_tools/external_graders.rst
.. _Using External Graders:
.. _External Grader:
###########################
Using External Graders
External Grader
###########################
......@@ -31,13 +31,13 @@ An external grader is particularly useful for software programming courses where
For example, you define a problem that requires students to submit Python code, and create a set of tests that an external grader can run to verify the submissions. When a student enters Python code for the problem and clicks **Check**, the code is sent to the grader for testing. If the code passes all tests, the grader returns the score and a string indicating that the solution is correct.
.. image:: ../Images/external-grader-correct.png
.. image:: /Images/external-grader-correct.png
:alt: Image of a students view of a programming problem that uses an external grader, with a correct result
The external grader can return a string with results, which the student can see by clicking **See full output**. This can be particularly useful when the solution is not correct and you want to return information about the failed tests. For example:
.. image:: ../Images/external-grader-incorrect.png
.. image:: /Images/external-grader-incorrect.png
:alt: Image of a students view of a programming problem that uses an external grader, with a correct result
.. _External Graders and XQueue:
......
docs/en_us/course_authors/source/exercises_tools/full_screen_image.rst 0 → 100644
.. _Full Screen Image:
######################
Full Screen Image Tool
######################
Some large images are difficult for students to view in the courseware. The full screen image tool allows students to enlarge the image, so they can see all the detail in context.
****************************************
The Student View of a Full Screen Image
****************************************
The student sees the full screen image in a unit page. When the student hovers the mouse pointer over the image, the **Fullscreen** button appears:
.. image:: /Images/image-modal.png
:alt: Image of the full screen image tool with the Full Screen button.
When the student clicks **Fullscreen**, the image opens and expands in the full browser window. The buttons **Close**, **Zoom In**, and **Zoom Out** appear:
.. image:: /Images/image-modal-window.png
:alt: Image of the Image Modal tool with the Full Screen button.
The student can then zoom in on the image, and drag the image to view the desired part of it:
.. image:: /Images/image-modeal-zoomed.png
:alt: Image of the Image Modal tool with the Full Screen button.
******************************
Create a Full Screen Image
******************************
#. Upload your image file to the **Files & Uploads** page. For more information about how to do this, see :ref:`Add Files to a Course`.
#. Under **Add New Component**, click **html**, and then click **Full Screen Image**.
#. In the new component that appears, click **Edit**.
#. In the component editor, replace the default title, remove the instructional paragraph, and add text as needed.
#. Switch to the **HTML** tab.
#. Replace the following placeholders with your own content.
* Replace the value of the <a> element's href attribute with the path to your image. Do not change the value of the class attribute. For example:
**<a href="/static/Image1.jpg" class="modal-content">**
* Replace the value of the <img> element's src attribute with the path to your image. For example:
**<img alt="Full screen image" src="/static/Image1.jpg"/>**
* Ensure that the value of the href and src attributes are the same, and that you do not change the class attribute. Your sample code should look like the following:
.. code-block:: xml
<h2>Sample Image Modal</h2>
<a href="/static/Image1.jpg" class="modal-content">
<img alt="Full screen image" src="/static/Image1.jpg"/>
</a>
.. note:: You can use this same HTML code in any HTML component, not just those components you created as full screen images.
#. Click **Save** to save the HTML component.
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/gene_explorer.rst 0 → 100644
.. _Gene Explorer:
##################
Gene Explorer Tool
##################
The Gene Explorer (GeneX), from the biology department at `UMB <http://www.umb.edu/>`_, simulates the transcription, splicing, processing, and translation of a small hypothetical eukaryotic gene. GeneX allows students to make specific mutations in a gene sequence, and it then calculates and displays the effects of the mutations on the mRNA and protein.
Specifically, the Gene Explorer does the following:
#. Finds the promoter and terminator
#. Reads the DNA sequence to produce the pre-mRNA
#. Finds the splice sites
#. Splices and tails the mRNA
#. Finds the start codon
#. Translates the mRNA
.. image:: /Images/GeneExplorer.png
:alt: Image of the Gene Explorer
For more information about the Gene Explorer, see `The Gene Explorer <http://intro.bio.umb.edu/GX/>`_.
********************
Gene Explorer Code
********************
.. code-block:: xml
<problem>
<p>Make a single base pair substitution mutation in the gene below that results in a protein that is longer than the protein produced by the original gene. When you are satisfied with your change and its effect, click the <b>SUBMIT</b> button.</p>
<p>Note that a "single base pair substitution mutation" is when a single base is changed to another base; for example, changing the A at position 80 to a T. Deletions and insertions are not allowed.</p>
<script type="loncapa/python">
def genex_grader(expect,ans):
if ans=="CORRECT": return True
import json
ans=json.loads(ans)
return ans["genex_answer"]=="CORRECT"
</script>
<customresponse cfn="genex_grader">
<editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_problem_number="2"/>
</customresponse>
</problem>
In this code:
* **width** and **height** specify the dimensions of the application, in pixels.
* **genex_dna_sequence** is the default DNA sequence that appears when the problem opens.
* **dna_sequence** contains the application's state and the student's answer. This value must be the same as **genex_dna_sequence**.
* **genex_problem_number** specifies the number of the problem. This number is based on the five gene editor problems in the MITx 7.00x course--for example, if you want this problem to look like the second gene editor problem in the 7.00x course, you would set the **genex_problem_number** value to 2. The number must be 1, 2, 3, 4, or 5.
\ No newline at end of file
docs/en_us/course_authors/source/problems_tools/google_hangouts.rst → docs/en_us/course_authors/source/exercises_tools/google_hangouts.rst
.. _Using an Instant Hangout in Your Course:
.. _Google Instant Hangout:
###########################################
Using an Instant Hangout in Your Course
Google Instant Hangout Tool
###########################################
This chapter describes how you can use instant hangouts in your course. See:
......@@ -52,28 +52,28 @@ The Student Experience
When you add the instant hangout to your course, a control for the hangout appears on that page. The following example shows the control in a course unit. The control shows that the student can start the hangout and be the first participant.
.. image:: ../Images/hangout_unit.png
.. image:: /Images/hangout_unit.png
:alt: Image of the instant hangout control on a unit
To start the hangout, the student clicks **Start the Hangout**. (After the first student clicks **Start the Hangout**, other students see a **Join the Hangout** button.)
The following example shows the control in a page when a hangout has already started. The control has a **Join the Hangout** button, and shows that one other student is already in the hangout.
.. image:: ../Images/hangout_static_page.png
.. image:: /Images/hangout_static_page.png
:alt: Image of the instant hangout control on a page
To join the hangout, the student clicks **Join the Hangout**.
If not already logged in, the student is prompted to log in to Google:
.. image:: ../Images/google_login.png
.. image:: /Images/google_login.png
:alt: Image of the Google login page
Students who do not have a Google account can create one from the login page.
After the student has logged in to Google, the hangout opens in a separate browser window:
.. image:: ../Images/hangout.png
.. image:: /Images/GoogleHangout_WithPeople.png
:alt: Image of the instant hangout
.. _Limitations:
......
docs/en_us/course_authors/source/exercises_tools/image_mapped_input.rst 0 → 100644
.. _Image Mapped Input:
###########################
Image Mapped Input Problem
###########################
In an image mapped input problem, students click inside a defined area in an image. You define this area by including coordinates in the body of the problem.
.. image:: /Images/ImageMappedInputExample.png
:alt: Image of an image mapped input problem
****************************************
Create an Image Mapped Input Problem
****************************************
To create a image mapped input problem:
#. In the unit where you want to create the problem, click **Problem**
under **Add New Component**, and then click the **Advanced** tab.
#. Click **Image Mapped Input**.
#. In the component that appears, click **Edit**.
#. In the component editor, replace the example code with your own code.
#. Click **Save**.
**Problem Code**:
.. code-block:: xml
<problem>
<p><b>Example Problem</b></p>
<startouttext/>
<p>In the image below, click the triangle.</p>
<endouttext/>
<imageresponse>
<imageinput src="/static/threeshapes.png" width="220" height="150" rectangle="(80,40)-(130,90)" />
</imageresponse>
</problem>
.. _Image Mapped Input Problem XML:
******************************
Image Mapped Input Problem XML
******************************
==========
Template
==========
.. code-block:: xml
<problem>
<startouttext/>
<p>In the image below, click the triangle.</p>
<endouttext/>
<imageresponse>
<imageinput src="IMAGE FILE PATH" width="NUMBER" height="NUMBER" rectangle="(X-AXIS,Y-AXIS)-(X-AXIS,Y-AXIS)" />
</imageresponse>
</problem>
=====
Tags
=====
* ``<imageresponse>``: Indicates that the problem is an image mapped input problem.
* ``<imageinput>``: Specifies the image file and the region in the file that the student must click.
**Tag:** ``<imageresponse>``
Indicates that the problem is an image mapped input problem.
Attributes
(none)
Children
* ``<imageinput>``
**Tag:** ``<imageinput>``
Specifies the image file and the region in the file that the student must click.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - src (required)
- The URL of the image
* - height (required)
- The height of the image, in pixels
* - width (required)
- The width of the image, in pixels
* - rectangle (required)
- An attribute with four embedded values in the format (<start_width>,<start_height>)-(<end_width>,<end-height>). All coordinates start with (0,0) in the top left corner and increase in value toward the bottom right corner, very similar to the progression of reading English. The two coordinates defined form the two opposite corners of a box which a student can click inside of.
Children
(none)
docs/en_us/course_authors/source/exercises_tools/index.rst 0 → 100644
.. _Exercises and Tools Index:
############################
Creating Exercises and Tools
############################
.. toctree::
:maxdepth: 2
create_exercises_and_tools
annotation
checkbox
chemical_equation
circuit_schematic_builder
conditional_module
custom_javascript
custom_python
drag_and_drop
dropdown
external_graders
full_screen_image
gene_explorer
google_hangouts
image_mapped_input
lti_component
math_expression_input
molecule_editor
multiple_choice
mult_choice_num_input
numerical_input
open_response_assessment
periodic_table
poll
problem_with_hint
problem_in_latex
protein_builder
text_input
word_cloud
zooming_image
mathjax
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/lti_component.rst 0 → 100644
.. _LTI Component:
###############
LTI Component
###############
You may have discovered or developed an external learning application
that you want to add to your online course. Or, you may have a digital
copy of your textbook that uses a format other than PDF. You can add
external learning applications or textbooks to Studio by using a
Learning Tools Interoperability (LTI) component. The LTI component is
based on the `IMS Global Learning Tools
Interoperability <http://www.imsglobal.org/LTI/v1p1p1/ltiIMGv1p1p1.html>`_
version 1.1.1 specifications.
You can use an LTI component in two ways.
- You can add external LTI content that is displayed only, such as
textbook content that doesn’t require a student response.
- You can add external LTI content that requires a student response. An
external provider will grade student responses.
For example, the following LTI component incorporates a Cerego tool that students interact with.
.. image:: /Images/LTIExample.png
:alt: Cerebro LTI component example
Before you create an LTI component from an external LTI provider in a
unit, you need the following information.
- The **LTI ID**. This is a value that you create to refer to the external LTI
provider. You should create an LTI ID that you can remember easily.
The LTI ID can contain uppercase and lowercase alphanumeric
characters, as well as underscore characters (_). It can contain any
number of characters. For example, you may create an LTI ID that is
as simple as **test_lti_id**, or your LTI ID may be a string of
numbers and letters such as **id_21441** or
**book_lti_provider_from_new_york**.
- The **client key**. This value is a sequence of characters that you
obtain from the LTI provider. The client key is used for
authentication and can contain any number of characters. For example,
your client key may be **b289378-f88d-2929-ctools.umich.edu**.
- The **client secret**. This value is a sequence of characters that
you obtain from the LTI provider. The client secret is used for
authentication and can contain any number of characters. For example,
your client secret may be something as simple as **secret**, or it
may be a string of numbers and letters such as **23746387264** or
**yt4984yr8**.
- The **launch URL** (if the LTI component requires a student response
that will be graded). You obtain the launch URL from the LTI
provider. The launch URL is the URL that Studio sends to the external
LTI provider so that the provider can send back students’ grades.
************************
Create an LTI Component
************************
Creating an LTI component in your course has three steps.
#. Add LTI to the **advanced_modules** policy key.
#. Register the LTI provider.
#. Create the LTI component in an individual unit.
======================================================
Step 1. Add LTI to the Advanced Modules Policy Key
======================================================
#. On the **Settings** menu, click **Advanced Settings**.
#. On the **Advanced Settings** page, locate the **Manual Policy
Definition** section, and then locate the **advanced_modules**
policy key (this key is at the top of the list).
.. image:: /Images/AdvancedModulesEmpty.png
:alt: Image of the advanced_modules key in the Advanced Settings page
#. Under **Policy Value**, place your cursor between the brackets, and
then enter **“lti”**. Make sure to include the quotation marks, but
not the period.
.. image:: /Images/LTIPolicyKey.png
:alt: Image of the advanced_modules key in the Advanced Settings page, with the LTI value added
**Note** If the **Policy Value** field already contains text, place your
cursor directly after the closing quotation mark for the final item, and
then enter a comma followed by **“lti”** (make sure that you include the
quotation marks).
#. At the bottom of the page, click **Save Changes**.
The page refreshes automatically. At the top of the page,
you see a notification that your changes have been saved.
==========================================
Step 2. Register the External LTI Provider
==========================================
To regiser the external LTI provider, you’ll add the LIT ID, the client
key, and the client secret in the **lti_passports** policy key.
#. On the **Advanced Settings** page, locate the **lti_passports**
policy key.
#. Under **Policy Value**, place your cursor between the brackets, and
then enter the LTI ID, client key, and client secret in the following
format (make sure to include the quotation marks and the colons).
::
“lti_id:client_key:client_secret”
For example, the value in the **lti_passports** field may be the following.
::
“test_lti_id:b289378-f88d-2929-ctools.umich.edu:secret”
If you have multiple LTI providers, separate the values with a comma.
Make sure to surround each entry with quotation marks.
::
"test_lti_id:b289378-f88d-2929-ctools.umich.edu:secret",
"id_21441:b289378-f88d-2929-ctools.school.edu:23746387264",
"book_lti_provider_from_new_york:b289378-f88d-2929-ctools.company.com:yt4984yr8"
#. At the bottom of the page, click **Save Changes**.
The page refreshes automatically. At the top of the page,
you see a notification that your changes have been saved, and you can
see your entries in the **lti_passports** policy key.
==========================================
Step 3. Add the LTI Component to a Unit
==========================================
#. In the unit where you want to create the problem, click **Advanced**
under **Add New Component**, and then click **LTI**.
#. In the component that appears, click **Edit**.
#. In the component editor, set the options that you want. See the table
below for a description of each option.
#. Click **Save**.
.. list-table::
:widths: 10 80
:header-rows: 1
* - `Setting`
- Description
* - `Display Name`
- Specifies the name of the problem. This name appears above the problem and in
the course ribbon at the top of the page in the courseware.
* - `custom_parameters`
- Enables you to add one or more custom parameters. For example, if you've added an
e-book, a custom parameter may include the page that your e-book should open to.
You could also use a custom parameter to set the background color of the LTI component.
Every custom parameter has a key and a value. You must add the key and value in the following format.
::
key=value
For example, a custom parameter may resemble the following.
::
bgcolor=red
page=144
To add a custom parameter, click **Add**.
* - `graded`
- Indicates whether the grade for the problem counts towards student's total grade. By
default, this value is set to **False**.
* - `has_score`
- Specifies whether the problem has a numerical score. By default, this value
is set to **False**.
* - `launch_url`
- Lists the URL that Studio sends to the external LTI provider so that the provider
can send back students' grades. This setting is only used if **graded** is set to
**True**.
* - `lti_id`
- Specifies the LTI ID for the external LTI provider. This value must be the same
LTI ID that you entered on the **Advanced Settings** page.
* - `open_in_a_new_page`
- Indicates whether the problem opens in a new page. If you set this value to **True**,
the student clicks a link that opens the LTI content in a new window. If you set
this value to **False**, the LTI content opens in an IFrame in the current page.
* - `weight`
- Specifies the number of points possible for the problem. By default, if an
external LTI provider grades the problem, the problem is worth 1 point, and
a student’s score can be any value between 0 and 1.
For more information about problem weights and computing point scores, see :ref:`Problem Weight`.
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/math_expression_input.rst 0 → 100644
.. _Math Expression Input:
####################################
Math Expression Input Problems
####################################
In math expression input problems, students enter text that represents a mathematical expression into a field, and text is converted to a symbolic expression that appears below that field. Unlike numerical input problems, which only allow integers and a few select constants, math expression problems can include unknown variables and more complicated symbolic expressions.
.. image:: /Images/MathExpressionInputExample.png
:alt: Image of math expression input problem
For more information about characters that students can enter, see :ref:`Math Response Formatting for Students`.
The grader uses a numerical sampling to determine whether the student's response matches the instructor-provided math expression, to a specified numerical tolerance. The instructor must specify the allowed variables in the expression as well as the range of values for each variable.
.. warning:: Math expression input problems cannot currently include negative numbers raised to fractional powers, such as (-1)^(1/2). Math expression input problems can include complex numbers raised to fractional powers, or positive non-complex numbers raised to fractional powers.
When you create a math expression input problem in Studio, you'll use `MathJax <http://www.mathjax.org>`_ to change your plain text into "beautiful math." For more information about how to use MathJax in Studio, see :ref:`MathJax in Studio`.
************************************************
Create a Math Expression Input Problem
************************************************
To create a math expression input problem:
#. In the unit where you want to create the problem, click **Problem**
under **Add New Component**, and then click the **Advanced** tab.
#. Click **Math Expression Input**.
#. In the component that appears, click **Edit**.
#. In the component editor, replace the example code with your own code. To practice, you may want to use the sample problem code below.
#. Click **Save**.
**Sample Problem Code**
.. code-block:: xml
<problem>
<p>Some problems may ask for a mathematical expression. Practice creating mathematical expressions by answering the questions below.</p>
<p>Write an expression for the product of R_1, R_2, and the inverse of R_3.</p>
<formularesponse type="ci" samples="R_1,R_2,R_3@1,2,3:3,4,5#10" answer="$VoVi">
<responseparam type="tolerance" default="0.00001"/>
<formulaequationinput size="40" label="Enter the equation"/>
</formularesponse>
<script type="loncapa/python">
VoVi = "(R_1*R_2)/R_3"
</script>
<p>Let <i>x</i> be a variable, and let <i>n</i> be an arbitrary constant. What is the derivative of <i>x<sup>n</sup></i>?</p>
<script type="loncapa/python">
derivative = "n*x^(n-1)"
</script>
<formularesponse type="ci" samples="x,n@1,2:3,4#10" answer="$derivative">
<responseparam type="tolerance" default="0.00001"/>
<formulaequationinput size="40" label="Enter the equation"/>
</formularesponse>
<solution>
<div class="detailed-solution">
<p>Explanation or Solution Header</p>
<p>Explanation or solution text</p>
</div>
</solution>
</problem>
.. _Math Expression Input Problem XML:
**********************************
Math Expression Input Problem XML
**********************************
============
Templates
============
.. code-block:: xml
<problem>
<p>Write an expression for the product of R_1, R_2, and the inverse of R_3.</p>
<formularesponse type="ci" samples="R_1,R_2,R_3@1,2,3:3,4,5#10" answer="R_1*R_2/R_3">
<responseparam type="tolerance" default="0.00001"/>
<formulaequationinput size="40" />
</formularesponse>
</problem>
.. code-block:: xml
<problem>
<p>Problem text</p>
<formularesponse type="ci" samples="VARIABLES@LOWER_BOUNDS:UPPER_BOUNDS#NUMBER_OF_SAMPLES" answer="$VoVi">
<responseparam type="tolerance" default="0.00001"/>
<formulaequationinput size="20" label="Enter the equation"/>
</formularesponse>
<script type="loncapa/python">
PYTHON SCRIPT
</script>
<solution>
<div class="detailed-solution">
<p>Explanation or Solution Header</p>
<p>Explanation or solution text</p>
</div>
</solution>
</problem>
====
Tags
====
* ``<formularesponse>``
* ``<formulaequationinput />``
* ``<responseparam>``
* ``<script>``
**Tag:** ``<formularesponse>``
Specifies that the problem is a math expression input problem. The ``<formularesponse>`` tag is similar to ``<numericalresponse>``, but ``<formularesponse>`` allows unknown variables.
Attributes
**type**: Can be "cs" (case sensitive, the default) or "ci" (case insensitive, so that capitalization doesn't matter in variable names).
**answer**: The correct answer to the problem, given as a mathematical expression. If you precede a variable name in the problem with a dollar sign ($), you can include a script in the problem that computes the expression in terms of that variable.
**samples**: Specifies important information about the problem in four lists:
* **variables**: A set of variables that students can enter.
* **lower_bounds**: For every defined variable, a lower bound on the numerical tests to use for that variable.
* **upper_bounds**: For every defined variable, an upper bound on the numerical tests to use for that variable.
* **num_samples**: The number of times to test the expression.
Commas separate items inside each of the four individual lists, and the at sign (@), colon (:), and pound sign (#) characters separate the four lists. The format is the following:
``"variables@lower_bounds:upper_bounds#num_samples``
For example, a ``<formularesponse>`` tag that includes the **samples** attribute may look like either of the following.
``<formularesponse samples="x,n@1,2:3,4#10">``
``<formularesponse samples="R_1,R_2,R_3@1,2,3:3,4,5#10">``
Children
* ``<formulaequationinput />``
**Tag:** ``<formulaequationinput />``
Creates a response field where a student types an answer to the problem in plain text, as well as a second field below the response field where the student sees a typeset version of the plain text. The parser that renders the student's plain text into typeset math is the same parser that evaluates the student's response for grading.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - size (optional)
- Specifies the width, in characters, of the response field where students enter answers.
Children
(none)
**Tag:** ``<responseparam>``
Used to define an upper bound on the variance of the numerical methods used to approximate a test for equality.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - default (required)
- A number or a percentage specifying how close the student and grader expressions must be. Failure to include a tolerance leaves expressions vulnerable to unavoidable rounding errors during sapling, causing some student input to be graded as incorrect, even if it is algebraically equivalent to the grader's expression.
* - type
- "tolerance"--defines a tolerance for a number
Children
(none)
docs/en_us/course_authors/source/problems_tools/g.rst → docs/en_us/course_authors/source/exercises_tools/mathjax.rst
.. _MathJax in Studio:
############################################
A Brief Introduction to MathJax in Studio
=========================================
############################################
To write clear and professional-looking symbols and equations, we use a LaTeX-like
language called
......@@ -36,17 +37,18 @@ You can use MathJax in HTML (text) components and in Problem components.
.. note:: Complete MathJax documentation (together with a testing tool) can be
found at `http://www.onemathematicalcat.org/MathJaxDocumentation/TeXSyntax.htm <http://www.google.com/url?q=http%3A%2F%2Fwww.onemathematicalcat.org%2FMathJaxDocumentation%2FTeXSyntax.htm&sa=D&sntz=1&usg=AFQjCNEV8PtCX6Csp0lW7lDKOLIKCOCkHg>`_.
****************************
HTML (Text) Components
----------------------
****************************
In the HTML component editor, you can use MathJax both in Visual view and in HTML view.
.. image:: ../Images/MathJax_HTML.png
.. image:: /Images/MathJax_HTML.png
:alt: Image of an HTML component with MathJax in both the Visual and HTML views
*********************
Problem Components
------------------
*********************
In the Problem component editor, you can use MathJax both in the Simple Editor
and in the Advanced Editor.
......@@ -56,5 +58,5 @@ explanation is enclosed in backslashes and parentheses, so it appears inline wit
Navier-Stokes equation is enclosed in backslashes and brackets, so it appears on its
own line.
.. image:: ../Images/MathJax_Problem.png
.. image:: /Images/MathJax_Problem.png
:alt: Image of a problem component with MathJax in both the Visual and HTML views
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/molecule_editor.rst 0 → 100644
.. _Molecule Editor:
#######################
Molecule Editor Tool
#######################
Students can use the molecule editor to learn how to create molecules. The molecule editor allows students to draw molecules that follow the rules for covalent bond formation and formal charge, even if the molecules are chemically impossible, are unstable, or do not exist in living systems. The molecule editor warns students if they try to submit a structure that is chemically impossible.
The molecule editor incorporates two tools: the JSME molecule editor created by Peter Erl and Bruno Bienfait, and JSmol, a JavaScript-based molecular viewer from Jmol. (You don't need to download either of these tools--Studio uses them automatically.) For more information about the JSME molecule editor, see `JSME Molecule Editor <http://peter-ertl.com/jsme/index.html>`_. For more information about JSmol, see `JSmol <http://sourceforge.net/projects/jsmol/>`_.
.. image:: /Images/Molecule_Editor.png
:alt: Image of the molecule editor
.. _Create the Molecule Editor:
******************************
Create the Molecule Editor
******************************
To create a molecule editor, you need the following files:
* MoleculeAnswer.png
* MoleculeEditor_HTML.png
* dopamine.mol
To download all of these files in a .zip archive, go to http://files.edx.org/MoleculeEditorFiles.zip.
.. note:: The molecule that appears when the tool starts is a dopamine molecule. To use a different molecule, download the .mol file for that molecule from the `list of molecules <http://www.biotopics.co.uk/jsmol/molecules/>`_ on the `BioTopics <http://www.biotopics.co.uk/>`_ website. Then, upload the .mol file to the **Files & Uploads** page for your course in Studio, and change "dopamine.mol" in the example code to the name of your .mol file.
To create the molecule editor that appears in the image above, you need an HTML component followed by a Problem component.
#. Upload all of the files listed above to the **Files & Uploads** page in your course.
#. Create the HTML component.
#. In the unit where you want to create the problem, click **HTML** under **Add New Component**, and then click **HTML**.
#. In the component that appears, click **Edit**.
#. In the component editor, paste the HTML component code from below.
#. Make any changes that you want, and then click **Save**.
3. Create the Problem component.
#. Under the HTML component, click **Problem** under **Add New Component**, and then click **Blank Advanced Problem**.
#. In the component that appears, click **Edit**.
#. In the component editor, paste the Problem component code from below.
#. Click **Save**.
.. _EMC Problem Code:
========================
Molecule Editor Code
========================
To create the molecule editor, you need an HTML component and a Problem component.
HTML Component Code
***************************
.. code-block:: xml
<h2>Molecule Editor</h2>
<p>The molecule editor makes creating and visualizing molecules easy. A chemistry professor may have you build and submit a molecule as part of an exercise.</p>
<div>
<script type="text/javascript">// <![CDATA[
function toggle2(showHideDiv, switchTextDiv) {
var ele = document.getElementById(showHideDiv);
var text = document.getElementById(switchTextDiv);
if(ele.style.display == "block") {
ele.style.display = "none";
text.innerHTML = "+ open";
}
else {
ele.style.display = "block";
text.innerHTML = "- close";
}
}
// ]]></script>
</div>
<div>
<style type="text/css"></style>
</div>
<div id="headerDiv">
<div id="titleText">Using the Molecule Editor<a id="myHeader" href="javascript:toggle2('myContent','myHeader');">+ open </a></div>
</div>
<div id="contentDiv">
<div id="myContent" style="display: none;">
<p>In this problem you will edit a molecule using the molecular drawing program shown below:</p>
<img alt="" src="/static/MoleculeEditor_HTML.png" /></div>
</div>
<p>&nbsp;</p>
<div id="headerDiv">
<div id="titleText">Are the molecules I've drawn chemically possible?<a id="IntroductionHeader" href="javascript:toggle2('IntroductionContent','IntroductionHeader');">+ open </a></div>
</div>
<div id="contentDiv">
<div id="IntroductionContent" style="display: none;">
<p>The chemical editor you are using ensures that the structures you draw are correct in one very narrow sense, that they follow the rules for covalent bond formation and formal charge. However, there are many structures that follow these rules that are chemically impossible, unstable, do not exist in living systems, or are beyond the scope of this course. The editor will let you draw them because, in contrast to the rules of formal charge, these properties cannot be easily and reliably predicted from structures.</p>
<p>If you submit a structure that includes atoms that are not possible or are beyond the scope of this course, the software will warn you specifically about these parts of your structure and you will be allowed to edit your structure and re-submit. Submitting an improper structure will not count as one of your tries. In general, you should try to use only the atoms most commonly cited in this course: C, H, N, O, P, and S. If you want to learn about formal charge, you can play around with other atoms and unusual configurations and look at the structures that result.</p>
</div>
</div>
<div id="ap_listener_added">&nbsp;</div>
Problem Component Code
***************************
.. code-block:: xml
<problem>
<p>The dopamine molecule, as shown, cannot make ionic bonds. Edit the dopamine molecule so it can make ionic bonds.</p>
<p>When you are ready, click Check. If you need to start over, click Reset.</p>
<script type="loncapa/python">
def check1(expect, ans):
import json
mol_info = json.loads(ans)["info"]
return any(res == "Can Make Ionic Bonds" for res in mol_info)
</script>
<customresponse cfn="check1">
<editamoleculeinput file="/static/dopamine.mol">
</editamoleculeinput>
</customresponse>
<solution>
<img src="/static/MoleculeAnswer.png"/>
</solution>
</problem>
**Problem 2**
::
<problem>
<p>The dopamine molecule, as shown, cannot make strong hydrogen bonds. Edit the dopamine molecule so that it can make strong hydrogen bonds.</p>
<script type="loncapa/python">
def grader_1(expect, ans):
import json
mol_info = json.loads(ans)["info"]
return any(res == "Cannot Make Strong Hydrogen Bonds" for res in mol_info)
</script>
<customresponse cfn="grader_1">
<editamoleculeinput file="/static/dopamine.mol">
</editamoleculeinput>
</customresponse>
</problem>
**Problem 3**
::
<problem>
<p>The dopamine molecule has an intermediate hydrophobicity. Edit the dopamine molecule so that it is more hydrophobic.</p>
<script type="loncapa/python">
def grader_2(expect, ans):
import json
mol_info = json.loads(ans)["info"]
hydrophobicity_index_str=mol_info[0]
hydrophobicity_index=float(hydrophobicity_index_str[23:])
return hydrophobicity_index &gt; .490
</script>
<customresponse cfn="grader_2">
<editamoleculeinput file="/static/dopamine.mol">
</editamoleculeinput>
</customresponse>
</problem>
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/mult_choice_num_input.rst 0 → 100644
.. _Multiple Choice and Numerical Input:
############################################
Multiple Choice and Numerical Input Problem
############################################
You can create a problem that combines a multiple choice and numerical input problems. Students not only select a response from options that you provide, but also provide more specific information, if necessary.
.. image:: /Images/MultipleChoice_NumericalInput.png
:alt: Image of a multiple choice and numerical input problem
.. note:: Currently, students can only enter numerals in the text field. Students cannot enter words or mathematical expressions.
.. _Create an MCNI Problem:
********************************************************
Create a Multiple Choice and Numerical Input Problem
********************************************************
To create a multiple choice and numerical input problem:
#. In the unit where you want to create the problem, click **Problem** under **Add New Component**, and then click the **Advanced** tab.
#. Click **Blank Advanced Problem**.
#. In the component that appears, click **Edit**.
#. In the component editor, paste the code from below.
#. Replace the example problem and response options with your own text.
#. Click **Save**.
.. _MCNI Problem Code:
************************************************
Multiple Choice and Numerical Input Problem Code
************************************************
.. code-block:: xml
<problem>
The numerical value of pi, rounded to two decimal points, is 3.24.
<choicetextresponse>
<radiotextgroup>
<choice correct="false">True.</choice>
<choice correct="true">False. The correct value is <numtolerance_input answer="3.14"/>.</choice>
</radiotextgroup>
</choicetextresponse>
</problem>
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/multiple_choice.rst 0 → 100644
.. _Multiple Choice:
########################
Multiple Choice Problem
########################
In multiple choice problems, students select one option from a list of answer options. Unlike with dropdown problems, whose answer choices don't appear until the student clicks the drop-down arrow, answer choices for multiple choice problems are always visible directly below the question.
.. image:: /Images/MultipleChoiceExample.png
:alt: Image of a multiple choice problem
****************************************
Create a Multiple Choice Problem
****************************************
You can create multiple choice problems in the Simple Editor or in the Advanced Editor.
.. note:: All problems must include labels for accessibility. The label generally includes the text of the main question in your problem. To add a label for a common problem, surround the text of the label with angle brackets pointed toward the text (>>label text<<).
================
Simple Editor
================
#. Under **Add New Component**, click **Problem**.
#. In the **Select Problem Component Type** screen, click **Multiple
Choice** on the **Common Problem Types** tab.
#. When the new Problem component appears, click **Edit**.
#. In the component editor, replace the sample problem text with the text of your
problem. Enter each answer option on its own line.
#. Determine the text of the problem to use as a label, and then surround that text with two sets of angle brackets (>><<).
#. Select all the answer options, and then click the multiple choice button.
.. image:: /Images/ProbCompButton_MultChoice.png
:alt: Image of the multiple choice button
When you do this, the component editor adds a pair of parentheses next to each
possible answer.
#. Add an "x" between the parentheses next to the correct answer.
#. In the component editor, select the text of the explanation, and then click the
explanation button to add explanation tags around the text.
.. image:: /Images/ProbCompButton_Explanation.png
:alt: Image of the explanation button
#. On the **Settings** tab, specify the settings that you want.
#. Click **Save**.
For the example problem above, the text in the Problem component is the
following.
::
>>Lateral inhibition, as was first discovered in the horsehoe crab:<<
( ) is a property of touch sensation, referring to the ability of crabs to
detect nearby predators.
( ) is a property of hearing, referring to the ability of crabs to detect
low frequency noises.
(x) is a property of vision, referring to the ability of crabs eyes to
enhance contrasts.
( ) has to do with the ability of crabs to use sonar to detect fellow horseshoe
crabs nearby.
( ) has to do with a weighting system in the crabs skeleton that allows it to
balance in turbulent water.
[Explanation]
Horseshoe crabs were essential to the discovery of lateral inhibition, a property of
vision present in horseshoe crabs as well as humans, that enables enhancement of
contrast at edges of objects as was demonstrated in class. In 1967, Haldan Hartline
received the Nobel prize for his research on vision and in particular his research
investigating lateral inhibition using horseshoe crabs.
[Explanation]
================
Advanced Editor
================
To create this problem in the Advanced Editor, click the **Advanced** tab in the Problem component editor, and then replace the existing code with the following code.
.. code-block:: xml
<problem>
<p>Lateral inhibition, as was first discovered in the horsehoe crab...</p>
<multiplechoiceresponse>
<choicegroup type="MultipleChoice" label="Lateral inhibition, as was first discovered in the horsehoe crab">
<choice correct="false">is a property of touch sensation, referring to the ability of crabs to detect nearby predators.</choice>
<choice correct="false">is a property of hearing, referring to the ability of crabs to detect low frequency noises.</choice>
<choice correct="false">is a property of vision, referring to the ability of crabs eyes to enhance contrasts.</choice>
<choice correct="true">has to do with the ability of crabs to use sonar to detect fellow horseshoe crabs nearby.</choice>
<choice correct="false">has to do with a weighting system in the crabs skeleton that allows it to balance in turbulent water.</choice>
</choicegroup>
</multiplechoiceresponse>
<solution>
<div class="detailed-solution">
<p>Explanation</p>
<p>Horseshoe crabs were essential to the discovery of lateral inhibition, a property of vision present in horseshoe crabs as well as humans, that enables enhancement of contrast at edges of objects as was demonstrated in class. In 1967, Haldan Hartline received the Nobel prize for his research on vision and in particular his research investigating lateral inhibition using horseshoe crabs.</p>
</div>
</solution>
</problem>
.. _Multiple Choice Problem XML:
******************************
Multiple Choice Problem XML
******************************
================
Template
================
.. code-block:: xml
<problem>
<p>Question text</p>
<multiplechoiceresponse>
<choicegroup type="MultipleChoice" label="label text">
<choice correct="false" name="a">Incorrect choice</choice>
<choice correct="true" name="b">Correct choice</choice>
</choicegroup>
</multiplechoiceresponse>
<solution>
<div class="detailed-solution">
<p>Explanation or solution header</p>
<p>Explanation or solution text</p>
</div>
</solution>
</problem>
================
Tags
================
* ``<multiplechoiceresponse>`` (required): Indicates that the problem is a multiple choice problem.
* ``<choicegroup>`` (required): Indicates the beginning of the list of options.
* ``<choice>`` (required): Lists an answer option.
**Tag:** ``<multiplechoiceresponse>``
Indicates that the problem is a multiple choice problem.
Attributes
(none)
Children
* ``<choicegroup>``
* All standard HTML tags (can be used to format text)
**Tag:** ``<choicegroup>``
Indicates the beginning of the list of options.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - label (required)
- Specifies the name of the response field.
* - type (required)
- Must be set to "MultipleChoice".
Children
* ``<choice>``
**Tag:** ``<choice>``
Lists an answer option.
Attributes
.. list-table::
:widths: 20 80
* - Attribute
- Description
* - correct (at least one required)
- Indicates a correct or incorrect answer. When the attribute is set to "true", the choice is a correct answer. When the attribute is set to "false", the choice is an incorrect answer. Only one choice can be a correct answer.
* - name
- A unique name that the back end uses to refer to the choice.
Children
(none)
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/periodic_table.rst 0 → 100644
.. _Periodic Table:
#####################
Periodic Table Tool
#####################
You can create an interactive periodic table of the elements to help your students learn about various elements' properties. In the table below, detailed information about each element appears as the student moves the mouse over the element.
.. image:: /Images/Periodic_Table.png
:alt: Image of the interactive periodic table
.. _Create the Periodic Table:
******************************
Create the Periodic Table Tool
******************************
To create a periodic table, you need the following files:
* Periodic-Table.js
* Periodic-Table.css
* Periodic-Table-Colors.css
* PeriodicTableHTML.txt
To download all of these files in a .zip archive, click http://files.edx.org/PeriodicTableFiles.zip.
To create the periodic table, you need an HTML component.
#. Upload all of the files listed above *except PeriodicTable.txt* to the **Files & Uploads** page in your course.
#. In the unit where you want to create the problem, click **HTML** under **Add New Component**, and then click **HTML**.
#. In the component that appears, click **Edit**.
#. In the component editor, switch to the **HTML** tab.
#. Open the PeriodicTable.txt file in any text editor.
#. Copy all of the text in the PeriodicTable.txt file, and paste it into the HTML component editor. (Note that the PeriodicTableHTML.txt file contains over 6000 lines of code. Paste all of this code into the component editor.)
#. Click **Save**.
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/poll.rst 0 → 100644
.. _Poll:
##########
Poll Tool
##########
You can run polls in your course so that your students can share opinions on different questions.
.. image:: /Images/PollExample.png
.. note:: Creating a poll requires you to export your course, edit some of your course's XML files in a text editor, and then re-import your course. We recommend that you create a backup copy of your course before you create the poll. We also recommend that you only edit the files that will contain polls in the text editor if you're very familiar with editing XML.
**************
Terminology
**************
Sections, subsections, units, and components have different names in the **Course Outline** view and in the list of files that you'll see after you export your course and open the .xml files for editing. The following table lists the names of these elements in the **Course Outline** view and in a list of files.
.. list-table::
:widths: 15 15
:header-rows: 0
* - Course Outline View
- File List
* - Section
- Chapter
* - Subsection
- Sequential
* - Unit
- Vertical
* - Component
- Discussion, HTML, problem, or video
For example, when you want to find a specific section in your course, you'll look in the **Chapter** folder when you open the list of files that your course contains. To find a unit, you'll look in the **Vertical** folder.
.. _Create a Poll:
**************
Create a Poll
**************
#. In the unit where you want to create the poll, create components that contain all the content that you want *except* for the poll. Make a note of the 32-digit unit ID that appears in the **Unit Identifier** field under **Unit Location**.
#. Export your course. For information about how to do this, see :ref:`Exporting and Importing a Course`. Save the .tar.gz file that contains your course in a memorable location so that you can find it easily.
#. Locate the .tar.gz file that contains your course, and then unpack the .tar.gz file so that you can see its contents in a list of folders and files.
- To do this on a Windows computer, you'll need to download a third-party program. For more information, see `How to Unpack a tar File in Windows <http://www.haskell.org/haskellwiki/How_to_unpack_a_tar_file_in_Windows>`_, `How to Extract a Gz File <http://www.wikihow.com/Extract-a-Gz-File>`_, `The gzip Home Page <http://www.gzip.org/>`_, or the `Windows <http://www.ofzenandcomputing.com/how-to-open-tar-gz-files/#windows>`_ section of the `How to Open .tar.gz Files <http://www.ofzenandcomputing.com/how-to-open-tar-gz-files/>`_ page.
- For information about how to do this on a Mac, see the `Mac OS X <http://www.ofzenandcomputing.com/how-to-open-tar-gz-files/#mac-os-x>`_ section of the `How to Open .tar.gz Files <http://www.ofzenandcomputing.com/how-to-open-tar-gz-files/>`_ page.
#. In the list of folders and files, open the **Vertical** folder.
.. note:: If your unit is not published, open the **Drafts** folder, and then open the **Vertical** folder in the **Drafts** folder.
#. In the **Vertical** folder, locate the .xml file that has the same name as the unit ID that you noted in step 1, and then open the file in a text editor such as Sublime 2. For example, if the unit ID is e461de7fe2b84ebeabe1a97683360d31, you'll open the e461de7fe2b84ebeabe1a97683360d31.xml file.
The file contains a list of all the components in the unit, together with the URL names of the components. For example, the following file contains an HTML component followed by a Discussion component.
.. code-block:: xml
<vertical display_name="Test Unit">
<html url_name="b59c54e2f6fc4cf69ba3a43c49097d0b"/>
<discussion url_name="8320c3d511484f3b96bdedfd4a44ac8b"/>
</vertical>
#. Add the following poll code in the location where you want the poll. Change the text of the prompt to the text that you want.
.. code-block:: xml
<poll_question display_name="Poll Question">
<p>Text of the prompt</p>
<answer id="yes">Yes</answer>
<answer id="no">No</answer>
</poll_question>
In the example above, if you wanted your poll to appear between the HTML component and the Discussion component in the unit, your code would resemble the following.
.. code-block:: xml
<vertical display_name="Test Unit">
<html url_name="b59c54e2f6fc4cf69ba3a43c49097d0b"/>
<poll_question display_name="Poll Question">
<p>Text of the prompt</p>
<answer id="yes">Yes</answer>
<answer id="no">No</answer>
</poll_question>
<discussion url_name="8320c3d511484f3b96bdedfd4a44ac8b"/>
</vertical>
#. After you add the poll code, save and close the .xml file.
#. Re-package your course as a .tar.gz file.
* For information about how to do this on a Mac, see `How to Create a Tar GZip File from the Command Line <http://osxdaily.com/2012/04/05/create-tar-gzip/>`_.
* For information about how to do this on a Windows computer, see `How to Make a .tar.gz on Windows <http://stackoverflow.com/questions/12774707/how-to-make-a-tar-gz-on-windows>`_.
#. In Studio, re-import your course. You can now review the poll question and answers that you added in Studio.
.. note::
* Although polls render correctly in Studio, you cannot edit them in Studio. You will need to follow the export/import process outlined above to make any edits to your polls.
* A .csv file that contains student responses to the problem is not currently available for polls. However, you can obtain the aggregate data directly in the problem.
*********************
Format description
*********************
The main tag of Poll module input is:
.. code-block:: xml
<poll_question> ... </poll_question>
``poll_question`` can include any number of the following tags:
any xml and ``answer`` tag. All inner xml, except for ``answer`` tags, we call "question".
==================
poll_question tag
==================
Xmodule for creating poll functionality - voting system. The following attributes can
be specified for this tag::
name - Name of xmodule.
[display_name| AUTOGENERATE] - Display name of xmodule. When this attribute is not defined - display name autogenerate with some hash.
[reset | False] - Can reset/revote many time (value = True/False)
============
answer tag
============
Define one of the possible answer for poll module. The following attributes can
be specified for this tag::
id - unique identifier (using to identify the different answers)
Inner text - Display text for answer choice.
***********
Example
***********
==================
Example of poll
==================
.. code-block:: xml
<poll_question name="second_question" display_name="Second question">
<h3>Age</h3>
<p>How old are you?</p>
<answer id="less18">&lt; 18</answer>
<answer id="10_25">from 10 to 25</answer>
<answer id="more25">&gt; 25</answer>
</poll_question>
================================================
Example of poll with unable reset functionality
================================================
.. code-block:: xml
<poll_question name="first_question_with_reset" display_name="First question with reset"
reset="True">
<h3>Your gender</h3>
<p>You are man or woman?</p>
<answer id="man">Man</answer>
<answer id="woman">Woman</answer>
</poll_question>
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/problem_in_latex.rst 0 → 100644
.. _Problem Written in LaTeX:
############################
Problem Written in LaTeX
############################
.. warning:: This problem type is still a prototype and may not be supported in the future. By default, the ability to create these problems is not enabled in Studio. You must change the advanced settings in your course before you can create problems with LaTeX. Use this problem type with caution.
If you have an problem that is already written in LaTeX, you can use this problem type to easily convert your code into XML. After you paste your code into the LaTeX editor, you'll only need to make a few minor adjustments.
.. note:: If you want to use LaTeX to typeset mathematical expressions
in problems that you haven't yet written, use any of the other problem
templates together with `MathJax <http://www.mathjax.org>`_. For more
information about how to create mathematical expressions in Studio using
MathJax, see *A Brief Introduction to MathJax in Studio*.
.. image:: /Images/ProblemWrittenInLaTeX.png
:alt: Image of a problem written in LaTeX
************************************
Create a Problem Written in LaTeX
************************************
To create a problem written in LaTeX:
#. Enable the policy key in your course.
#. In Studio, click **Settings**, and then click **Advanced Settings**.
#. On the **Advanced Settings** page, scroll down to the **use_latex_compiler** policy key.
#. In the **Policy Value** field next to the **use_latex_compiler** policy key, change **false** to **true**.
#. At the bottom of the page, click **Save Changes**.
#. In the unit where you want to create the problem, click **Problem**
under **Add New Component**, and then click the **Advanced** tab.
#. Click **Problem Written in LaTeX**.
#. In the component editor that appears, click **Edit**.
#. In the lower left corner of the component editor, click **Launch
LaTeX Source Compiler**.
#. Replace the example code with your own code. You can also upload a Latex file into the editor from your computer by clicking **Upload** in the bottom right corner.
#. In the lower left corner of the LaTeX source compiler, click **Save &
Compile to edX XML**.
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/problem_with_hint.rst 0 → 100644
.. _Problem with Adaptive Hint:
################################
Problem with Adaptive Hint
################################
A problem with an adaptive hint evaluates a student's response, then gives the student feedback or a hint based on that response so that the student is more likely to answer correctly on the next attempt. These problems can be text input problems.
.. image:: /Images/ProblemWithAdaptiveHintExample.png
:alt: Image of a problem with an adaptive hint
******************************************
Create a Problem with an Adaptive Hint
******************************************
To create a problem with an adaptive hint:
#. In the unit where you want to create the problem, click **Problem**
under **Add New Component**, and then click the **Advanced** tab.
#. Click **Problem with Adaptive Hint**.
#. In the component that appears, click **Edit**.
#. In the component editor, replace the example code with your own code.
#. Click **Save**.
\ No newline at end of file
docs/en_us/course_authors/source/exercises_tools/protein_builder.rst 0 → 100644
.. _Protein Builder:
############################
Protex Protein Builder Tool
############################
The Protex protein builder asks students to create specified protein shapes by stringing together amino acids. In the example below, the goal protein shape is a simple line.
.. image:: /Images/ProteinBuilder.png
:alt: Image of the protein builder
.. _Create the Protein Builder:
********************************
Create the Protein Builder Tool
********************************
To create the protein builder:
#. Under **Add New Component**, click **Problem**, and then click **Blank Advanced Problem**.
#. In the component that appears, click **Edit**.
#. In the component editor, paste the Problem component code from below.
#. Make any changes that you want, and then click **Save**.
.. _Protein Builder Code:
*************************
Protein Builder Tool Code
*************************
.. code-block:: xml
<problem>
<p>The protein builder allows you string together the building blocks of proteins, amino acids, and see how that string will form into a structure. You are presented with a goal protein shape, and your task is to try to re-create it. In the example below, the shape that you are asked to form is a simple line.</p>
<p>Be sure to click "Fold" to fold your protein before you click "Check".</p>
<script type="loncapa/python">
def protex_grader(expect,ans):
import json
ans=json.loads(ans)
if "ERROR" in ans["protex_answer"]:
raise ValueError("Protex did not understand your answer. Try folding the protein.")
return ans["protex_answer"]=="CORRECT"
</script>
<text>
<customresponse cfn="protex_grader">
<designprotein2dinput width="855" height="500" target_shape="W;W;W;W;W;W;W"/>
</customresponse>
</text>
<solution>
<p>
Many protein sequences, such as the following example, fold to a straight line.You can play around with the protein builder if you're curious.
</p>
<ul>
<li>
Stick: RRRRRRR
</li>
</ul>
</solution>
</problem>
In this code:
* **width** and **height** specify the dimensions of the application, in pixels.
* **target_shape** lists the amino acids that, combined in the order specified, create the shape you've asked students to create. The list can only include the following letters, which correspond to the one-letter code for each amino acid. (This list appears in the upper-left corner of the protein builder.)
.. list-table::
:widths: 15 15 15 15
:header-rows: 0
* - A
- R
- N
- D
* - C
- Q
- E
- G
* - H
- I
- L
- K
* - M
- F
- P
- S
* - T
- W
- Y
- V
docs/en_us/course_authors/source/exercises_tools/word_cloud.rst 0 → 100644
.. _Word Cloud:
##################
Word Cloud Tool
##################
In a word cloud tool, students enter words into a field in response
to a question or prompt. The words all the students have entered then
appear instantly as a colorful graphic, with the most popular responses
appearing largest. The graphic becomes larger as more students answer.
Students can both see the way their peers have answered and contribute
their thoughts to the group.
For example, the following word cloud was created from students'
responses to a question in a HarvardX course.
.. image:: /Images/WordCloudExample.png
:alt: Image of a word cloud problem
****************************
Create a Word Cloud Tool
****************************
To create a word cloud tool:
#. Add the Word Cloud advanced component.
#. On the **Settings** menu, click **Advanced Settings**.
#. On the **Advanced Settings** page, locate the **Manual Policy Definition** section, and then locate the **advanced_modules** policy key (this key is at the top of the list).
#. Under **Policy Value**, place your cursor between the brackets, and
then enter the following. Make sure to include the quotation marks.
``"word_cloud"``
#. At the bottom of the page, click **Save Changes**.
The page refreshes automatically. At the top of the page, you see a
notification that your changes have been saved.
#. Return to the unit where you want to add the specialized problem. The
list of possible components now contains an Advanced component.
#. In the unit where you want to create the problem, click **Advanced**
under **Add New Component**.
#. In the list of problem types, click **Word Cloud**.
#. In the component that appears, click **Edit**.
#. In the component editor, specify the settings that you want. You can
leave the default value for everything except **Display Name**.
- **Display Name**: The name that appears in the course ribbon and
as a heading above the problem.
- **Inputs**: The number of text boxes into which students can enter
words, phrases, or sentences.
- **Maximum Words**: The maximum number of words that the word cloud
displays. If students enter 300 different words but the maximum is
set to 250, only the 250 most commonly entered words appear in the
word cloud.
- **Show Percents**: The number of times that students have entered
a given word as a percentage of all words entered appears near
that word.
#. Click **Save**.
docs/en_us/course_authors/source/exercises_tools/zooming_image.rst 0 → 100644
.. _Zooming Image:
##################
Zooming Image Tool
##################
You may want to present information to your students as an image. If your image is very large or very detailed, students may not be able to see all the information in the image. You can use the zooming image tool to enlarge areas of your image as the student moves the mouse over the image, as in the example below.
.. image:: /Images/Zooming_Image.png
:alt: Example zooming image tool showing a chemistry exercise
***********************************
Components of a Zooming Image Tool
***********************************
To create a zooming image tool, you need the following files.
* The image that you want students to see when they access the unit.
* The image that appears in the magnified area when a student clicks the regular image. This image may be larger than the regular image.
* The **jquery.loupeAndLightbox.js** JavaScript file. Every zooming image tool uses this JavaScript file, and you won't make any changes to it. `To download this file, right-click here <http://files.edx.org/jquery.loupeAndLightbox.js>`_, and then click **Save Link As** to save the file on your computer.
****************************
Create a Zooming Image Tool
****************************
#. Upload your regular-sized image file, your small image file, and the **jquery.loupeAndLightbox.js** file to the **Files & Uploads** page. For more information about how to do this, see :ref:`Add Files to a Course`.
#. Under **Add New Component**, click **html**, and then click **Zooming Image**.
#. In the new component that appears, click **Edit**.
#. In the component editor, replace the default problem text with your own text.
#. Switch to the **HTML** tab.
#. Replace the following placeholders with your own content.
- Replace the following file name and path with the name and path of the image that you want to appear magnified when the user hovers over the regular image.
**https://studio.edx.org/c4x/edX/DemoX/asset/pathways_detail_01.png**
For example, your file name and path may be **/static/Image1.jpg**.
- Replace the following file name and path with the name and path of the image that you want to appear when the page opens.
**https://studio.edx.org/c4x/edX/DemoX/asset/pathways_overview_01.png**
For example, your file name and path may be **/static/Image2.jpg**.
- Replace the following name and file path with the name and path of the JavaScript file for your course.
**https://studio.edx.org/c4x/edX/DemoX/asset/jquery.loupeAndLightbox.js**
Because you uploaded the **jquery.loupeAndLightbox.js** file to the **Files & Uploads** page, your file name and path is **/static/jquery.loupeAndLightbox.js**.
- (Optional) If you want the magnified area to be larger or smaller, change the **width** and **height** values from 350 to larger or smaller numbers. For example, you can change both numbers to 450. Or, if you want a horizontal oval instead of a circle, you can change the **width** value to a number such as 500 and the **height** value to a number such as 150.
The HTML in your zooming image tool may resemble the following.
.. image:: /Images/ZoomingImage_Modified.png
:alt: Example HTML for a zooming image tool
#. Click **Save** to save the HTML component.
docs/en_us/course_authors/source/getting_started/glossary.rst
......@@ -135,7 +135,7 @@ C
**Custom Response Problem**
A custom response problem evaluates text responses from students using an embedded Python script. These problems are also called "write-your-own-grader" problems. For more information, see :ref:`Custom Python Evaluated Input` Custom Python-evaluated input (also called "write-your-own-grader" problems evaluate students'.
A custom response problem evaluates text responses from students using an embedded Python script. These problems are also called "write-your-own-grader" problems. For more information, see :ref:`Write Your Own Grader`.
.. _D:
......@@ -324,7 +324,7 @@ M
A problem that requires students to enter a mathematical expression as text, such as e=m*c^2.
See :ref:`Math Expression Syntax` for more information.
See :ref:`Math Response Formatting for Students` for more information.
.. _MathJax:
......@@ -462,7 +462,7 @@ S
**Simple Editor**
The graphical user interface in a Problem component that contains formatting buttons and is available for some problem types. For more information, see :ref:`Studio UI`.
The graphical user interface in a Problem component that contains formatting buttons and is available for some problem types. For more information, see :ref:`Problem Studio View`.
......
docs/en_us/course_authors/source/index.rst
......@@ -16,7 +16,7 @@ Building and Running an edX Course
getting_started/index
building_course/index
creating_content/index
problems_tools/index
exercises_tools/index
releasing_course/index
running_course/index
students/index
\ No newline at end of file
docs/en_us/course_authors/source/problems_tools/index.rst deleted 100644 → 0
.. _Working with Problems Index:
##########################
Working with Problems
##########################
.. toctree::
:maxdepth: 2
create_problem_component
common_problems
advanced_problems
specialized_problems
e
external_graders
open_response_assessment
tools
additional_tools
google_hangouts
f
g
docs/en_us/course_authors/source/problems_tools/specialized_problems.rst deleted 100644 → 0
.. _Specialized Problems:
Specialized Problems
====================
Specialized problems are advanced problems such as annotations. These problems are available through the Advanced component in Studio. To add the Advanced component to your course, you'll modify your course's advanced settings. The Advanced component then appears under **Add New Component** in each unit.
- :ref:`Annotation` Annotation problems ask students to respond to
questions about a specific block of text. The question appears above
the text when the student hovers the mouse over the highlighted text
so that students can think about the question as they read.
- :ref:`Word Cloud` Word clouds arrange text that students enter - for example, in response to a question - into a colorful graphic that students can see.
.. _ Add Advanced Component:
**Add the Advanced Component to Your Course**
By default, when you create a new component in Studio, you see the
following options.
.. image:: ../Images/AddNewComponent.png
:alt: Image of the Add a New Component panel
To create a specialized problem, you must first add the Advanced
component to your course. To do this, follow these steps.
#. On the **Settings** menu, click **Advanced Settings**.
#. On the **Advanced Settings** page, locate the **Manual Policy
Definition** section, and then locate the **advanced_modules**
policy key (this key is at the top of the list).
.. image:: ../Images/AdvancedModulesEmpty.png
:alt: Image of the Manual Policy Definition section of the Advanced Settings page
3. Under **Policy Value**, place your cursor between the brackets, and
then enter the value for the type of problem that you want to create.
Make sure to include the quotation marks, but not the period.
- For annotations, enter **"annotatable"**.
- For word clouds, enter **"word_cloud"**.
You can enter more than one problem type at a time. When you do,
make sure to surround each problem type with quotation marks and
separate each problem type with a comma, but do not include any
spaces.
For example, if you wanted to add annotations and word cloud problems in your course, you would enter
the following between the brackets.
::
"annotatable","word_cloud"
.. image:: ../Images/AdvSettings_Before.png
:alt: Image of the Manual Policy Definition section of the Advanced Settings page, with specialized problems added
4. At the bottom of the page, click **Save Changes**.
The page refreshes automatically. At the top of the page, you see a
notification that your changes have been saved.
The text in the **Policy Value** field now appears as follows.
.. image:: ../Images/AdvSettings_After.png
:alt: Image of the Manual Policy Definition section of the Advanced Settings page, with specialized problems added after saving
5. Return to the unit where you want to add the specialized problem. The
list of possible components now contains an Advanced component.
.. image:: ../Images/AdvancedComponent.png
:alt: Image of the Add a New Component panel with the Advanced component option
When you click the Advanced component, you can see **Annotation** and **Word cloud** in the list. More information about how to create each problem is provided in the page for that problem type.
.. _Annotation:
Annotation
----------
In an annotation problem, the instructor highlights specific text
inside a larger text block and then asks questions about that text. The
questions appear when students hover the mouse over the highlighted
text. The questions also appear in a section below the text block, along
with space for students' responses.
.. image:: ../Images/AnnotationExample.png
:alt: Image of an annotation problem
Create an Annotation Problem
~~~~~~~~~~~~~~~~~~~~~~~~~~~~
To create an annotation problem:
Add the Annotation advanced component. To do this, add the "annotatable"
key value to the **Advanced Settings** page. (For more information, see
the instructions in :ref:`Specialized Problems`.)
Add the **Instructions** and **Guided Discussion** segments of the
problem.
#. In the unit where you want to create the problem, click **Advanced**
under **Add New Component**.
#. In the list of problem types, click **Annotation**.
#. In the component that appears, click **Edit**.
#. In the component editor, replace the example code with your own code.
#. Click **Save**.
Add the **Annotation problem** segment of the problem.
#. Under the Annotation component, create a new blank Advanced Problem
component.
#. Paste the following code in the Advanced Problem component, replacing
placeholders with your own information.
::
<problem>
<annotationresponse>
<annotationinput>
<text>PLACEHOLDER: Text of annotation</text>
<comment>PLACEHOLDER: Text of question</comment>
<comment_prompt>PLACEHOLDER: Type your response below:</comment_prompt>
<tag_prompt>PLACEHOLDER: In your response to this question, which tag below
do you choose?</tag_prompt>
<options>
<option choice="incorrect">PLACEHOLDER: Incorrect answer (to make this
option a correct or partially correct answer, change choice="incorrect"
to choice="correct" or choice="partially-correct")</option>
<option choice="correct">PLACEHOLDER: Correct answer (to make this option
an incorrect or partially correct answer, change choice="correct" to
choice="incorrect" or choice="partially-correct")</option>
<option choice="partially-correct">PLACEHOLDER: Partially correct answer
(to make this option a correct or partially correct answer,
change choice="partially-correct" to choice="correct" or choice="incorrect")
</option>
</options>
</annotationinput>
</annotationresponse>
<solution>
<p>PLACEHOLDER: Detailed explanation of solution</p>
</solution>
</problem>
#. Click **Save**.
docs/en_us/course_authors/source/students/index.rst
......@@ -7,5 +7,6 @@ Information for Your Students
.. toctree::
:maxdepth: 2
ora_students
login_guide
math_students
ora_students
docs/en_us/course_authors/source/students/math_students.rst 0 → 100644
.. _Math Response Formatting for Students:
#####################################
Math Response Formatting for Students
#####################################
In numerical input problems, the student's response may be more complicated than a
simple number. Expressions like ``sqrt(3)`` and even ``1+e^(sin(pi/2)+2*i)``
are valid, and evaluate to 1.73 and -0.13 + 2.47i, respectively.
The parser renders text that students enter into "beautiful math" that appears below the problem's response field:
.. image:: /Images/Math1.png
:alt: Image of a numerical input probem rendered by the parser
.. image:: /Images/Math2.png
:alt: Image of a numerical input probem rendered by the parser
.. image:: /Images/Math3.png
:alt: Image of a numerical input probem rendered by the parser
.. image:: /Images/Math4.png
:alt: Image of a numerical input probem rendered by the parser
.. image:: /Images/Math5.png
:alt: Image of a numerical input probem rendered by the parser
Students can enter any of the following into the response field.
*******
Numbers
*******
- Integers: '2520'
- Fractions: 2/3
- Normal floats: '3.14'
- With no integer part: '.98'
- Scientific notation: '1.2e-2' (=0.012)
- More scientific notation: '-4.4e+5' = '-4.4e5' (=-440,000)
- SI suffixes: '2.25k' (=2,250). The full list:
====== ========== ===============
Suffix Stands for Example
====== ========== ===============
% percent 0.01 = 1e-2
k kilo 1000 = 1e3
M mega 1e6
G giga 1e9
T tera 1e12
c centi 0.01 = 1e-2
m milli 0.001 = 1e-3
u micro 1e-6
n nano 1e-9
p pico 1e-12
====== ========== ===============
The largest possible number handled currently is exactly the largest float
possible (in the Python language). This number is 1.7977e+308. Any expression
containing larger values will not evaluate correctly, so it's best to avoid
this situation.
*********************
Default Constants
*********************
Simple and commonly used mathematical/scientific constants are included by
default. These include:
- ``i`` and ``j`` as ``sqrt(-1)``
- ``e`` as Euler's number (2.718...)
- ``g``: gravity (9.80 m/s^2)
- ``pi``
- ``k``: the Boltzmann constant (~1.38e-23 in Joules/Kelvin)
- ``c``: the speed of light in m/s (2.998e8)
- ``T``: the positive difference between 0K and 0°C (285.15)
- ``q``: the fundamental charge (~1.602e-19 Coloumbs)
**************
Greek Letters
**************
The parser automatically converts the following Greek letter names into the corresponding Greek characters:
.. list-table::
:widths: 20 20 20 20
:header-rows: 0
* - alpha
- beta
- gamma
- delta
* - epsilon
- varepsilon
- zeta
- eta
* - theta
- vartheta
- iota
- kappa
* - lambda
- mu
- nu
- xi
* - pi
- rho
- sigma
- tau
* - upsilon
- phi
- varphi
- chi
* - psi
- omega
-
-
.. note:: ``epsilon`` is the lunate version, whereas ``varepsilon`` looks like a backward 3.
****************************
Operators and Functions
****************************
* Use standard arithmetic operation symbols.
* Indicate multiplication explicitly by using an asterisk (*).
* Use a caret (^) to raise to a power.
* Use an underscore (_) to indicate a subscript.
* Use parentheses to specify the order of operations.
The normal operators apply (with normal order of operations):
``+ - * / ^``. Also provided is a special "parallel resistors" operator given
by ``||``. For example, an input of ``1 || 2`` would represent the resistance
of a pair of parallel resistors (of resistance 1 and 2 ohms), evaluating to 2/3
(ohms).
Currently, factorials written in the form '3!' are invalid, but
there is a workaround. Students can specify ``fact(3)`` or ``factorial(3)`` to
access the factorial function.
The default included functions are the following:
- Trig functions: sin, cos, tan, sec, csc, cot
- Their inverses: arcsin, arccos, arctan, arcsec, arccsc, arccot
- Other common functions: sqrt, log10, log2, ln, exp, abs
- Factorial: ``fact(3)`` or ``factorial(3)`` are valid. However, you must take
care to only input integers. For example, ``fact(1.5)`` would fail.
- Hyperbolic trig functions and their inverses: sinh, cosh, tanh, sech, csch,
coth, arcsinh, arccosh, arctanh, arcsech, arccsch, arccoth
\ No newline at end of file
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment