Skip to content

E
edx-platform
Commit f508bf11 by Sylvia Pearce
Options

Update info about gene explorer, molecule editor, and protein builder

parent 8eb704b0
Showing with 44 additions and 49 deletions
docs/en_us/course_authors/source/additional_tools.rst
...@@ -13,27 +13,38 @@ Individual course teams frequently create tools and problem types that don't hav ...@@ -13,27 +13,38 @@ Individual course teams frequently create tools and problem types that don't hav
Below, you'll find the information you need to create the following tools. Below, you'll find the information you need to create the following tools.
* :ref:`Gene Editor` * :ref:`Gene Explorer`
* :ref:`Interactive Periodic Table` * :ref:`Interactive Periodic Table`
* :ref:`Molecule Editor` * :ref:`Molecule Editor`
* :ref:`Multiple Choice and Numerical Input` * :ref:`Multiple Choice and Numerical Input`
* :ref:`Protein Builder` * :ref:`Protein Builder`
.. _Gene Editor: .. _Gene Explorer:
************************** **************************
Genex Gene Editor Gene Explorer
************************** **************************
.. warning:: Description of gene editor--I'm not sure what this tool does, exactly. Help? The Gene Explorer (GeneX), from the biology department at `UMB <http://www.umb.edu/>`_, simulates the transcription, splicing, processing, and translation of a small hypothetical eukaryotic gene. GeneX allows students to make specific mutations in a gene sequence, and it then calculates and displays the effects of the mutations on the mRNA and protein.
.. image:: /Images/GeneEditor.gif Specifically, the Gene Explorer does the following:
:alt: Image of the interactive periodic table
#. Finds the promoter and terminator
#. Reads the DNA sequence to produce the pre-mRNA
#. Finds the splice sites
#. Splices and tails the mRNA
#. Finds the start codon
#. Translates the mRNA
.. image:: /Images/GeneExplorer.png
:alt: Image of the Gene Explorer
.. _Create the Gene Editor: For more information about the Gene Explorer, see `The Gene Explorer <http://intro.bio.umb.edu/GX/>`_.
.. _Create the Gene Explorer:
========================== ==========================
Create the Gene Editor Create the Gene Explorer
========================== ==========================
#. In the unit where you want to create the problem, click **Problem** under **Add New Component**, and then click the **Advanced** tab. #. In the unit where you want to create the problem, click **Problem** under **Add New Component**, and then click the **Advanced** tab.
...@@ -43,40 +54,32 @@ Create the Gene Editor ...@@ -43,40 +54,32 @@ Create the Gene Editor
#. Click **Save**. #. Click **Save**.
===================== =====================
Gene Editor Code Gene Explorer Code
===================== =====================
.. warning:: Jean-Michel, can you provide problem text for this?
:: ::
<problem> <problem>
<script type="loncapa/python"> <p>Make a single base pair substitution mutation in the gene below that results in a protein that is longer than the protein produced by the original gene. When you are satisfied with your change and its effect, click the <b>SUBMIT</b> button.</p>
def genex_grader(expect,ans): <p>Note that a "single base pair substitution mutation" is when a single base is changed to another base; for example, changing the A at position 80 to a T. Deletions and insertions are not allowed.</p>
if ans=="CORRECT": return True <script type="loncapa/python">
import json def genex_grader(expect,ans):
ans=json.loads(ans) if ans=="CORRECT": return True
return ans["genex_answer"]=="CORRECT" import json
</script> ans=json.loads(ans)
<customresponse cfn="genex_grader"> return ans["genex_answer"]=="CORRECT"
<editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_problem_number="2"/> </script>
</customresponse> <customresponse cfn="genex_grader">
</problem> <editageneinput width="818" height="1000" dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_dna_sequence="TAAGGCTATAACCGAGATTGATGCCTTGTGCGATAAGGTGTGTCCCCCCCCAAAGTGTCGGATGTCGAGTGCGCGTGCAAAAAAAAACAAAGGCGAGGACCTTAAGAAGGTGTGAGGGGGCGCTCGAT" genex_problem_number="2"/>
</customresponse>
.. note:: </problem>
In this code: In this code:
* **width** and **height** specify the dimensions of the application, in pixels. * **width** and **height** specify the dimensions of the application, in pixels.
* **genex_dna_sequence** is the default DNA sequence that appears when the problem opens. * **genex_dna_sequence** is the default DNA sequence that appears when the problem opens.
* **dna_sequence** contains the application's state and the student's answer. This value must be the same as **genex_dna_sequence**. * **dna_sequence** contains the application's state and the student's answer. This value must be the same as **genex_dna_sequence**.
* **genex_problem_number** determines what the user has to find to answer the problem correctly. It is hard-coded in the Java GWT code that is used to produce the JS. Its value can range from 1 to 5 and corresponds to the 5 'Edit a Gene' problems encountered in 7.00x. * **genex_problem_number** specifies the number of the problem. This number is based on the five gene editor problems in the MITx 7.00x course--for example, if you want this problem to look like the second gene editor problem in the 7.00x course, you would set the **genex_problem_number** value to 2. The number must be 1, 2, 3, 4, or 5.
.. warning:: Jean-Michel: I'm not sure what to say about **genex_problem_number, since this info is just for 7.00x. Would something like this work?
**genex_problem_number** specifies the number of the problem. This number is based on the five gene editor problems in the MITx 7.00x course--for example, if you want this problem to look like the second gene editor problem in the 7.00x course, you would set the **genex_problem_number** value to 2. The number must be 1, 2, 3, 4, or 5.
(This seems a little odd--do all courses have to use the same five gene editor problems?)
.. _Interactive Periodic Table: .. _Interactive Periodic Table:
...@@ -121,9 +124,7 @@ To create the periodic table, you need an HTML component. ...@@ -121,9 +124,7 @@ To create the periodic table, you need an HTML component.
Molecule Editor Molecule Editor
************************ ************************
.. warning:: Jean-Michel: I started creating documentation for this a couple of weeks ago, based on the molecule editor in the demo course. In addition to the problem XML that you provided, that problem included some HTML text as well. Can you look over it and let me know if you think it's OK to keep that in? (To be honest, the two collapsible sections in the HTML component look kind of ugly in the LMS, so I'm happy to hear any suggestions for them.) Students can use the molecule editor to learn how to create molecules. The molecule editor allows students to draw molecules that follow the rules for covalent bond formation and formal charge, even if the molecules are chemically impossible, are unstable, or do not exist in living systems. The molecule editor warns students if they try to submit a structure that is chemically impossible.
Students can use the molecule editor to learn how to create molecules. The molecule editor allows students to draw molecules that follow the rules for covalent bond formation and formal charge, but are chemically impossible. The molecule editor warns students if they try to submit a structure that is not possible.
The molecule editor incorporates two tools: the JSME molecule editor created by Peter Erl and Bruno Bienfait, and JSmol, a JavaScript-based molecular viewer from Jmol. (You don't need to download either of these tools--Studio uses them automatically.) For more information about the JSME molecule editor, see `JSME Molecule Editor <http://peter-ertl.com/jsme/index.html>`_. For more information about JSmol, see `JSmol <http://sourceforge.net/projects/jsmol/>`_. The molecule editor incorporates two tools: the JSME molecule editor created by Peter Erl and Bruno Bienfait, and JSmol, a JavaScript-based molecular viewer from Jmol. (You don't need to download either of these tools--Studio uses them automatically.) For more information about the JSME molecule editor, see `JSME Molecule Editor <http://peter-ertl.com/jsme/index.html>`_. For more information about JSmol, see `JSmol <http://sourceforge.net/projects/jsmol/>`_.
...@@ -140,11 +141,11 @@ To create a molecule editor, you need the following files: ...@@ -140,11 +141,11 @@ To create a molecule editor, you need the following files:
* MoleculeAnswer.png * MoleculeAnswer.png
* MoleculeEditor_HTML.png * MoleculeEditor_HTML.png
* Molecules_Dopamine.mol * dopamine.mol
To download all of these files in a .zip archive, go to http://files.edx.org/MoleculeEditorFiles.zip. To download all of these files in a .zip archive, go to http://files.edx.org/MoleculeEditorFiles.zip.
.. note:: The molecule that appears when the tool starts is a dopamine molecule. To use a different molecule, download the .mol file for that molecule from the `list of molecules <http://www.biotopics.co.uk/jsmol/molecules/>`_ on the `BioTopics <http://www.biotopics.co.uk/>`_ website. Then, upload the .mol file to the **Files & Uploads** page for your course in Studio, and change "Molecules_Dopamine.mol" in the example code to the name of your .mol file. .. note:: The molecule that appears when the tool starts is a dopamine molecule. To use a different molecule, download the .mol file for that molecule from the `list of molecules <http://www.biotopics.co.uk/jsmol/molecules/>`_ on the `BioTopics <http://www.biotopics.co.uk/>`_ website. Then, upload the .mol file to the **Files & Uploads** page for your course in Studio, and change "dopamine.mol" in the example code to the name of your .mol file.
To create the molecule editor that appears in the image above, you need an HTML component followed by a Problem component. To create the molecule editor that appears in the image above, you need an HTML component followed by a Problem component.
...@@ -219,14 +220,6 @@ Problem Component ...@@ -219,14 +220,6 @@ Problem Component
**Problem 1** **Problem 1**
.. warning:: Jean-Michel: The code for Problem 3 is the code that's in the problem in the demo course (except that I changed the name of the dopamine.mol file to Dopamine_Molecule.mol). Is it still usable? (If not, no big deal.)
Also, can you supply sample text for the two sample problems you've provided? (For the first one, for example, it could just be "The dopamine molecule, as shown, cannot make strong hydrogen bonds. Edit the dopamine molecule so that it can make strong hydrogen bonds." But I'm not sure what the second one is trying to do.)
In problems 1 and 2, the file path is "/static/**molecules**/dopamine.mol". Should this just be "static/dopamine.mol"?
And one more thing: Problem 3 includes an answer. Do we want to do that for the other problems?
:: ::
<problem> <problem>
...@@ -239,7 +232,7 @@ Problem Component ...@@ -239,7 +232,7 @@ Problem Component
return any(res == "Can Make Ionic Bonds" for res in mol_info) return any(res == "Can Make Ionic Bonds" for res in mol_info)
</script> </script>
<customresponse cfn="check1"> <customresponse cfn="check1">
<editamoleculeinput file="/static/Molecules_Dopamine.mol"> <editamoleculeinput file="/static/dopamine.mol">
</editamoleculeinput> </editamoleculeinput>
</customresponse> </customresponse>
<solution> <solution>
...@@ -252,6 +245,7 @@ Problem Component ...@@ -252,6 +245,7 @@ Problem Component
:: ::
<problem> <problem>
<p>The dopamine molecule, as shown, cannot make strong hydrogen bonds. Edit the dopamine molecule so that it can make strong hydrogen bonds.</p>
<script type="loncapa/python"> <script type="loncapa/python">
def grader_1(expect, ans): def grader_1(expect, ans):
import json import json
...@@ -259,7 +253,7 @@ Problem Component ...@@ -259,7 +253,7 @@ Problem Component
return any(res == "Cannot Make Strong Hydrogen Bonds" for res in mol_info) return any(res == "Cannot Make Strong Hydrogen Bonds" for res in mol_info)
</script> </script>
<customresponse cfn="grader_1"> <customresponse cfn="grader_1">
<editamoleculeinput file="/static/molecules/dopamine.mol"> <editamoleculeinput file="/static/dopamine.mol">
</editamoleculeinput> </editamoleculeinput>
</customresponse> </customresponse>
</problem> </problem>
...@@ -268,7 +262,8 @@ Problem Component ...@@ -268,7 +262,8 @@ Problem Component
:: ::
<problem"> <problem>
<p>The dopamine molecule has an intermediate hydrophobicity. Edit the dopamine molecule so that it is more hydrophobic.</p>
<script type="loncapa/python"> <script type="loncapa/python">
def grader_2(expect, ans): def grader_2(expect, ans):
import json import json
...@@ -279,7 +274,7 @@ Problem Component ...@@ -279,7 +274,7 @@ Problem Component
return hydrophobicity_index &gt; .490 return hydrophobicity_index &gt; .490
</script> </script>
<customresponse cfn="grader_2"> <customresponse cfn="grader_2">
<editamoleculeinput file="/static/molecules/dopamine.mol"> <editamoleculeinput file="/static/dopamine.mol">
</editamoleculeinput> </editamoleculeinput>
</customresponse> </customresponse>
</problem> </problem>
......
Markdown is supported
0% or
You are about to add 0 people to the discussion. Proceed with caution.
Finish editing this message first!
Please register or to comment